EMAIL THIS PAGE TO A FRIEND

CDC40

cell division cycle 40

160 Gene Product Result for
Synonyms: EHB3 PRP17 PRPF17
UniProtKB ID: O60508, B2RBC5, O75471, Q5SRN0, Q9UPG1
Gene ID:
Human(51362) Summary: Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is found to be essential for the catalytic step II in pre-mRNA splicing process. It is found in the spliceosome, and contains seven WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp17 protein, which functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. It suggests that this protein may play a role in cell cycle progression. [provided by RefSeq, Jul 2008]
Mouse(71713) cell division cycle 40
Rat(361859) cell division cycle 40
Zebrafish(494534) cell division cycle 40 homolog (S. cerevisiae)
cow(514003) cell division cycle 40 homolog (S. cerevisiae)
domestic cat(101080793) cell division cycle 40 homolog (S. cerevisiae)
dog(475025) cell division cycle 40 homolog (S. cerevisiae)
chicken(421760) cell division cycle 40 homolog (S. cerevisiae)
naked mole-rat(101706880) cell division cycle 40
domestic guinea pig(100716434) cell division cycle 40
sheep(101112230) cell division cycle 40 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001477295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001477295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001477295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131201 MISSION® esiRNA esiRNA human CDC40 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015891 Rosetta Predictions human pricing
NM_001108538 Rosetta Predictions rat pricing
XM_001477295 Rosetta Predictions mouse pricing
XM_483893 Rosetta Predictions mouse pricing
XM_899505 Rosetta Predictions mouse pricing
XM_899512 Rosetta Predictions mouse pricing
XM_899530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074484 predicted 1487
2 SASI_Hs01_00074485 predicted 1073
3 SASI_Hs02_00348477 predicted 1020
4 SASI_Hs02_00348478 predicted 1268
5 SASI_Hs01_00074488 predicted 1183
6 SASI_Hs02_00348479 predicted 246
7 SASI_Hs01_00074490 predicted 1530
8 SASI_Hs02_00348480 predicted 1457
9 SASI_Hs01_00074491 predicted 203
10 SASI_Hs01_00074492 predicted 1317
11 SASI_Hs01_00074483 predicted 809
12 SASI_Hs01_00074486 predicted 1464
13 SASI_Hs01_00074487 predicted 929
14 SASI_Hs01_00074489 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239629 predicted 1785
2 SASI_Rn02_00239630 predicted 1699
3 SASI_Rn02_00239631 predicted 1457
4 SASI_Rn02_00239632 predicted 1891
5 SASI_Rn02_00239633 predicted 1326
6 SASI_Rn02_00239634 predicted 1238
7 SASI_Rn02_00239635 predicted 1652
8 SASI_Rn02_00239636 predicted 1277
9 SASI_Rn02_00239637 predicted 1413
10 SASI_Rn02_00239638 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00394868 predicted 772
2 SASI_Mm02_00394869 predicted 1673
3 SASI_Mm02_00394870 predicted 1629
4 SASI_Mm02_00394871 predicted 1009
5 SASI_Mm02_00394872 predicted 1929
6 SASI_Mm02_00394873 predicted 2120
7 SASI_Mm02_00394874 predicted 2035
8 SASI_Mm02_00394875 predicted 1080
9 SASI_Mm02_00394876 predicted 1623
10 SASI_Mm02_00394877 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_483893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202180 predicted 688
2 SASI_Mm02_00426359 predicted 575
3 SASI_Mm01_00202181 predicted 509
4 SASI_Mm01_00202182 predicted 695
5 SASI_Mm01_00202183 predicted 698
6 SASI_Mm01_00202185 predicted 546
7 SASI_Mm01_00202186 predicted 698
8 SASI_Mm01_00202187 predicted 631
9 SASI_Mm01_00202188 predicted 711
10 SASI_Mm01_00202189 predicted 664
11 SASI_Mm01_00202184 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227855 predicted 696
2 SASI_Mm01_00227856 predicted 516
3 SASI_Mm01_00227857 predicted 702
4 SASI_Mm01_00227858 predicted 695
5 SASI_Mm01_00227859 predicted 675
6 SASI_Mm01_00227860 predicted 551
7 SASI_Mm01_00227861 predicted 703
8 SASI_Mm01_00227862 predicted 643
9 SASI_Mm01_00227863 predicted 708
10 SASI_Mm01_00227864 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264108 predicted 1170
2 SASI_Mm01_00264109 predicted 721
3 SASI_Mm01_00264110 predicted 676
4 SASI_Mm01_00264111 predicted 1013
5 SASI_Mm01_00264112 predicted 685
6 SASI_Mm01_00264113 predicted 824
7 SASI_Mm01_00264114 predicted 517
8 SASI_Mm01_00264115 predicted 1002
9 SASI_Mm01_00264116 predicted 1058
10 SASI_Mm01_00264117 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208360 predicted 694
2 SASI_Mm01_00208361 predicted 509
3 SASI_Mm01_00208362 predicted 705
4 SASI_Mm01_00208363 predicted 701
5 SASI_Mm01_00208364 predicted 681
6 SASI_Mm01_00208365 predicted 548
7 SASI_Mm01_00208366 predicted 710
8 SASI_Mm01_00208367 predicted 643
9 SASI_Mm01_00208368 predicted 710
10 SASI_Mm01_00208369 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001477295
VALIDATED
CDC40 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477295.1-1930s21c1
Sequence:CCGGTCGCTTTAAAGCCCATGATAACTCGAGTTATCATGGGCTTTAAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-712s21c1
Sequence:CCGGACTGGACCCTTCGTTAGATAACTCGAGTTATCTAACGAAGGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-2155s21c1
Sequence:CCGGGCCTTATGATGTTGGCCTATTCTCGAGAATAGGCCAACATCATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-1577s21c1
Sequence:CCGGGTTGATGAGAACCGAAGATTCCTCGAGGAATCTTCGGTTCTCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-1262s21c1
Sequence:CCGGCGGCGCTGTCTGAGAACATTTCTCGAGAAATGTTCTCAGACAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001477295
VALIDATED
CDC40 MISSION shRNA shRNA Plasmid DNA
cell division cycle 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477295.1-1930s21c1
Sequence:CCGGTCGCTTTAAAGCCCATGATAACTCGAGTTATCATGGGCTTTAAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-712s21c1
Sequence:CCGGACTGGACCCTTCGTTAGATAACTCGAGTTATCTAACGAAGGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-2155s21c1
Sequence:CCGGGCCTTATGATGTTGGCCTATTCTCGAGAATAGGCCAACATCATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-1577s21c1
Sequence:CCGGGTTGATGAGAACCGAAGATTCCTCGAGGAATCTTCGGTTCTCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-1262s21c1
Sequence:CCGGCGGCGCTGTCTGAGAACATTTCTCGAGAAATGTTCTCAGACAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001477295
VALIDATED
CDC40 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477295.1-1930s21c1
Sequence:CCGGTCGCTTTAAAGCCCATGATAACTCGAGTTATCATGGGCTTTAAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-712s21c1
Sequence:CCGGACTGGACCCTTCGTTAGATAACTCGAGTTATCTAACGAAGGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-2155s21c1
Sequence:CCGGGCCTTATGATGTTGGCCTATTCTCGAGAATAGGCCAACATCATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-1577s21c1
Sequence:CCGGGTTGATGAGAACCGAAGATTCCTCGAGGAATCTTCGGTTCTCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001477295.1-1262s21c1
Sequence:CCGGCGGCGCTGTCTGAGAACATTTCTCGAGAAATGTTCTCAGACAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015891
VALIDATED
CDC40 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 40
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-131s21c1
Sequence:CCGGCCCTCATGCACTTGACTAAATCTCGAGATTTAGTCAAGTGCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-961s21c1
Sequence:CCGGATTAAGCTATGGGAGGTTTATCTCGAGATAAACCTCCCATAGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015891.2-2212s21c1
Sequence:CCGGACAGTTACTCTCCCTATTATTCTCGAGAATAATAGGGAGAGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-1074s21c1
Sequence:CCGGAGCCTATGACAGGTATCTTAACTCGAGTTAAGATACCTGTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-372s21c1
Sequence:CCGGACCAGCTCATATCAATGATTTCTCGAGAAATCATTGATATGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015891.x-1001s1c1
Sequence:CCGGGAACATTTATTGGTCACAGTACTCGAGTACTGTGACCAATAAATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015891.x-1347s1c1
Sequence:CCGGCCTAAGAGTTTGGGAATGGGACTCGAGTCCCATTCCCAAACTCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015891.x-214s1c1
Sequence:CCGGGAAGATTTGGAGACTGGAGTTCTCGAGAACTCCAGTCTCCAAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_015891.x-1491s1c1
Sequence:CCGGAGCACAGAACAGATTTAGATTCTCGAGAATCTAAATCTGTTCTGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015891.x-282s1c1
Sequence:CCGGGACCATGTTTGCTCCTGAGTTCTCGAGAACTCAGGAGCAAACATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015891
VALIDATED
CDC40 MISSION shRNA shRNA Plasmid DNA
cell division cycle 40
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-131s21c1
Sequence:CCGGCCCTCATGCACTTGACTAAATCTCGAGATTTAGTCAAGTGCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-961s21c1
Sequence:CCGGATTAAGCTATGGGAGGTTTATCTCGAGATAAACCTCCCATAGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015891.2-2212s21c1
Sequence:CCGGACAGTTACTCTCCCTATTATTCTCGAGAATAATAGGGAGAGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-1074s21c1
Sequence:CCGGAGCCTATGACAGGTATCTTAACTCGAGTTAAGATACCTGTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-372s21c1
Sequence:CCGGACCAGCTCATATCAATGATTTCTCGAGAAATCATTGATATGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015891.x-1001s1c1
Sequence:CCGGGAACATTTATTGGTCACAGTACTCGAGTACTGTGACCAATAAATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015891.x-1347s1c1
Sequence:CCGGCCTAAGAGTTTGGGAATGGGACTCGAGTCCCATTCCCAAACTCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015891.x-214s1c1
Sequence:CCGGGAAGATTTGGAGACTGGAGTTCTCGAGAACTCCAGTCTCCAAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_015891.x-1491s1c1
Sequence:CCGGAGCACAGAACAGATTTAGATTCTCGAGAATCTAAATCTGTTCTGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015891.x-282s1c1
Sequence:CCGGGACCATGTTTGCTCCTGAGTTCTCGAGAACTCAGGAGCAAACATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015891
VALIDATED
CDC40 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 40
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-131s21c1
Sequence:CCGGCCCTCATGCACTTGACTAAATCTCGAGATTTAGTCAAGTGCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-961s21c1
Sequence:CCGGATTAAGCTATGGGAGGTTTATCTCGAGATAAACCTCCCATAGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015891.2-2212s21c1
Sequence:CCGGACAGTTACTCTCCCTATTATTCTCGAGAATAATAGGGAGAGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-1074s21c1
Sequence:CCGGAGCCTATGACAGGTATCTTAACTCGAGTTAAGATACCTGTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015891.2-372s21c1
Sequence:CCGGACCAGCTCATATCAATGATTTCTCGAGAAATCATTGATATGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015891.x-1001s1c1
Sequence:CCGGGAACATTTATTGGTCACAGTACTCGAGTACTGTGACCAATAAATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015891.x-1347s1c1
Sequence:CCGGCCTAAGAGTTTGGGAATGGGACTCGAGTCCCATTCCCAAACTCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015891.x-214s1c1
Sequence:CCGGGAAGATTTGGAGACTGGAGTTCTCGAGAACTCCAGTCTCCAAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_015891.x-1491s1c1
Sequence:CCGGAGCACAGAACAGATTTAGATTCTCGAGAATCTAAATCTGTTCTGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015891.x-282s1c1
Sequence:CCGGGACCATGTTTGCTCCTGAGTTCTCGAGAACTCAGGAGCAAACATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027879
VALIDATED
CDC40 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 40
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000255499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027879.1-1821s21c1
Sequence:CCGGTTTCACTGTCTGGGATCATTTCTCGAGAAATGATCCCAGACAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027879
VALIDATED
CDC40 MISSION shRNA shRNA Plasmid DNA
cell division cycle 40
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000255499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027879.1-1821s21c1
Sequence:CCGGTTTCACTGTCTGGGATCATTTCTCGAGAAATGATCCCAGACAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027879
VALIDATED
CDC40 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 40
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000255499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027879.1-1821s21c1
Sequence:CCGGTTTCACTGTCTGGGATCATTTCTCGAGAAATGATCCCAGACAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks