EMAIL THIS PAGE TO A FRIEND

CDC42

cell division cycle 42

213 Gene Product Result for
Synonyms: CDC42Hs G25K
UniProtKB ID: P60953, P21181, P25763, Q7L8R5, Q9UDI2
Gene ID:
Human(998) Summary: The protein encoded by this gene is a small GTPase of the Rho-subfamily, which regulates signaling pathways that control diverse cellular functions including cell morphology, migration, endocytosis and cell cycle progression. This protein is highly similar to Saccharomyces cerevisiae Cdc 42, and is able to complement the yeast cdc42-1 mutant. The product of oncogene Dbl was reported to specifically catalyze the dissociation of GDP from this protein. This protein could regulate actin polymerization through its direct binding to Neural Wiskott-Aldrich syndrome protein (N-WASP), which subsequently activates Arp2/3 complex. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes of this gene have been identified on chromosomes 3, 4, 5, 7, 8 and 20. [provided by RefSeq, Apr 2013]
Mouse(12540) cell division cycle 42
Rat(64465) cell division cycle 42 (GTP binding protein)
sheep(101102792) cell division cycle 42 (GTP binding protein, 25kDa)
domestic guinea pig(100717195) cell division cycle 42
naked mole-rat(101701374) cell division cycle 42
Zebrafish(336839) cell division cycle 42
fruit fly(32981) CG12530 gene product from transcript CG12530-RC
cow(532712) cell division cycle 42 (GTP binding protein, 25kDa)
domestic cat(101094772) cell division cycle 42 (GTP binding protein, 25kDa)
dog(403934) cell division cycle 42 (GTP binding protein, 25kDa)
chicken(395917) cell division cycle 42 (GTP binding protein, 25kDa)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001791 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039802 Rosetta Predictions human pricing
NM_001791 Rosetta Predictions human pricing
NM_044472 Rosetta Predictions human pricing
NM_171994 Rosetta Predictions rat pricing
NM_009861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113094 predicted 492
2 SASI_Hs01_00113095 predicted 482
3 SASI_Hs01_00113096 predicted 499
4 SASI_Hs01_00113097 predicted 499
5 SASI_Hs01_00113098 predicted 495
6 SASI_Hs01_00113099 predicted 495
7 SASI_Hs01_00113100 predicted 626
8 SASI_Hs01_00113101 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222990 predicted 361
2 SASI_Hs02_00332553 predicted 388
3 SASI_Hs02_00332554 predicted 389
4 SASI_Hs01_00222987 predicted 354
5 SASI_Hs02_00332555 predicted 391
6 SASI_Hs02_00332556 predicted 381
7 SASI_Hs01_00222988 predicted 353
8 SASI_Hs01_00222989 predicted 368
9 SASI_Hs02_00332557 predicted 369
10 SASI_Hs02_00332558 predicted 373
11 SASI_Hs01_00222991 predicted 367
12 SASI_Hs01_00222992 predicted 368
13 SASI_Hs01_00222993 predicted 494
14 SASI_Hs01_00222994 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_044472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361481 predicted 659
2 SASI_Hs02_00361482 predicted 652
3 SASI_Hs02_00361483 predicted 661
4 SASI_Hs02_00361484 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115812 predicted 427
2 SASI_Rn01_00115813 predicted 468
3 SASI_Rn01_00115814 predicted 516
4 SASI_Rn01_00115815 predicted 563
5 SASI_Rn01_00115816 predicted 322
6 SASI_Rn01_00115817 predicted 422
7 SASI_Rn01_00115818 predicted 271
8 SASI_Rn01_00115819 predicted 260
9 SASI_Rn01_00115820 predicted 411
10 SASI_Rn01_00115821 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317284 predicted 211
2 SASI_Mm02_00317285 predicted 230
3 SASI_Mm02_00317286 predicted 228
4 SASI_Mm02_00317287 predicted 206
5 SASI_Mm02_00317288 predicted 385
6 SASI_Mm01_00158253 predicted 333
7 SASI_Mm02_00317289 predicted 471
8 SASI_Mm01_00158256 predicted 613
9 SASI_Mm02_00317290 predicted 263
10 SASI_Mm02_00317291 predicted 479
11 SASI_Mm01_00158249 predicted 270
12 SASI_Mm01_00158250 predicted 675
13 SASI_Mm01_00158251 predicted 274
14 SASI_Mm01_00158252 predicted 409
15 SASI_Mm01_00158254 predicted 565
16 SASI_Mm01_00158255 predicted 629
17 SASI_Mm01_00158257 predicted 464
18 SASI_Mm01_00158258 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001791
VALIDATED
CDC42 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 42
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001791.2-493s1c1
Sequence:CCGGCCAAGAACAAACAGAAGCCTACTCGAGTAGGCTTCTGTTTGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001791.2-193s1c1
Sequence:CCGGCGGAATATGTACCGACTGTTTCTCGAGAAACAGTCGGTACATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001791.2-161s1c1
Sequence:CCGGCCTGATATCCTACACAACAAACTCGAGTTTGTTGTGTAGGATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001791.2-471s1c1
Sequence:CCGGCCCTCTACTATTGAGAAACTTCTCGAGAAGTTTCTCAATAGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001791.2-328s1c1
Sequence:CCGGCAGATGTATTTCTAGTCTGTTCTCGAGAACAGACTAGAAATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001791.3-1125s21c1
Sequence:GTACCGGGAGTAATCTGGGACATCTTAGCTCGAGCTAAGATGTCCCAGATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-609s21c1
Sequence:GTACCGGACCTGAAGGCTGTCAAGTATGCTCGAGCATACTTGACAGCCTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-390s21c1
Sequence:CCGGCAGATGTATTTCTAGTCTGTTCTCGAGAACAGACTAGAAATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-223s21c1
Sequence:CCGGCCTGATATCCTACACAACAAACTCGAGTTTGTTGTGTAGGATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-498s21c1
Sequence:CCGGTGCTTGTTGGGACTCAAATTGCTCGAGCAATTTGAGTCCCAACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-644s21c1
Sequence:CCGGCTTACACAGAAAGGCCTAAAGCTCGAGCTTTAGGCCTTTCTGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001791.3-1069s21c1
Sequence:CCGGGACTCTGTAACAGACTAATTGCTCGAGCAATTAGTCTGTTACAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-362s21c1
Sequence:GTACCGGAGATTACGACCGCTGAGTTATCTCGAGATAACTCAGCGGTCGTAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001791
VALIDATED
CDC42 MISSION shRNA shRNA Plasmid DNA
cell division cycle 42
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001791.2-493s1c1
Sequence:CCGGCCAAGAACAAACAGAAGCCTACTCGAGTAGGCTTCTGTTTGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001791.2-193s1c1
Sequence:CCGGCGGAATATGTACCGACTGTTTCTCGAGAAACAGTCGGTACATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001791.2-161s1c1
Sequence:CCGGCCTGATATCCTACACAACAAACTCGAGTTTGTTGTGTAGGATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001791.2-471s1c1
Sequence:CCGGCCCTCTACTATTGAGAAACTTCTCGAGAAGTTTCTCAATAGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001791.2-328s1c1
Sequence:CCGGCAGATGTATTTCTAGTCTGTTCTCGAGAACAGACTAGAAATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001791.3-1125s21c1
Sequence:GTACCGGGAGTAATCTGGGACATCTTAGCTCGAGCTAAGATGTCCCAGATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-609s21c1
Sequence:GTACCGGACCTGAAGGCTGTCAAGTATGCTCGAGCATACTTGACAGCCTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-390s21c1
Sequence:CCGGCAGATGTATTTCTAGTCTGTTCTCGAGAACAGACTAGAAATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-223s21c1
Sequence:CCGGCCTGATATCCTACACAACAAACTCGAGTTTGTTGTGTAGGATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-498s21c1
Sequence:CCGGTGCTTGTTGGGACTCAAATTGCTCGAGCAATTTGAGTCCCAACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-644s21c1
Sequence:CCGGCTTACACAGAAAGGCCTAAAGCTCGAGCTTTAGGCCTTTCTGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001791.3-1069s21c1
Sequence:CCGGGACTCTGTAACAGACTAATTGCTCGAGCAATTAGTCTGTTACAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-362s21c1
Sequence:GTACCGGAGATTACGACCGCTGAGTTATCTCGAGATAACTCAGCGGTCGTAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001791
VALIDATED
CDC42 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 42
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001791.2-493s1c1
Sequence:CCGGCCAAGAACAAACAGAAGCCTACTCGAGTAGGCTTCTGTTTGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001791.2-193s1c1
Sequence:CCGGCGGAATATGTACCGACTGTTTCTCGAGAAACAGTCGGTACATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001791.2-161s1c1
Sequence:CCGGCCTGATATCCTACACAACAAACTCGAGTTTGTTGTGTAGGATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001791.2-471s1c1
Sequence:CCGGCCCTCTACTATTGAGAAACTTCTCGAGAAGTTTCTCAATAGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001791.2-328s1c1
Sequence:CCGGCAGATGTATTTCTAGTCTGTTCTCGAGAACAGACTAGAAATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001791.3-1125s21c1
Sequence:GTACCGGGAGTAATCTGGGACATCTTAGCTCGAGCTAAGATGTCCCAGATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-609s21c1
Sequence:GTACCGGACCTGAAGGCTGTCAAGTATGCTCGAGCATACTTGACAGCCTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-390s21c1
Sequence:CCGGCAGATGTATTTCTAGTCTGTTCTCGAGAACAGACTAGAAATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-223s21c1
Sequence:CCGGCCTGATATCCTACACAACAAACTCGAGTTTGTTGTGTAGGATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-498s21c1
Sequence:CCGGTGCTTGTTGGGACTCAAATTGCTCGAGCAATTTGAGTCCCAACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-644s21c1
Sequence:CCGGCTTACACAGAAAGGCCTAAAGCTCGAGCTTTAGGCCTTTCTGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001791.3-1069s21c1
Sequence:CCGGGACTCTGTAACAGACTAATTGCTCGAGCAATTAGTCTGTTACAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001791.3-362s21c1
Sequence:GTACCGGAGATTACGACCGCTGAGTTATCTCGAGATAACTCAGCGGTCGTAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009861
VALIDATED
CDC42 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 42
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-277s1c1
Sequence:CCGGCCGCTAAGTTATCCACAGACACTCGAGTGTCTGTGGATAACTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-401s1c1
Sequence:CCGGTCTTGCTTGTTGGGACCCAAACTCGAGTTTGGGTCCCAACAAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-384s1c1
Sequence:CCGGCTGTCCAAAGACTCCTTTCTTCTCGAGAAGAAAGGAGTCTTTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-218s1c1
Sequence:CCGGAGCCATACACTCTTGGACTTTCTCGAGAAAGTCCAAGAGTGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-161s1c1
Sequence:CCGGCGGAATATGTACCAACTGTTTCTCGAGAAACAGTTGGTACATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-471s21c1
Sequence:CCGGTCTTGCTTGTTGGGACCCAAACTCGAGTTTGGGTCCCAACAAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-231s21c1
Sequence:CCGGCGGAATATGTACCAACTGTTTCTCGAGAAACAGTTGGTACATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-347s21c1
Sequence:CCGGCCGCTAAGTTATCCACAGACACTCGAGTGTCTGTGGATAACTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-288s21c1
Sequence:CCGGAGCCATACACTCTTGGACTTTCTCGAGAAAGTCCAAGAGTGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-454s21c1
Sequence:CCGGCTGTCCAAAGACTCCTTTCTTCTCGAGAAGAAAGGAGTCTTTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009861
VALIDATED
CDC42 MISSION shRNA shRNA Plasmid DNA
cell division cycle 42
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-277s1c1
Sequence:CCGGCCGCTAAGTTATCCACAGACACTCGAGTGTCTGTGGATAACTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-401s1c1
Sequence:CCGGTCTTGCTTGTTGGGACCCAAACTCGAGTTTGGGTCCCAACAAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-384s1c1
Sequence:CCGGCTGTCCAAAGACTCCTTTCTTCTCGAGAAGAAAGGAGTCTTTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-218s1c1
Sequence:CCGGAGCCATACACTCTTGGACTTTCTCGAGAAAGTCCAAGAGTGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-161s1c1
Sequence:CCGGCGGAATATGTACCAACTGTTTCTCGAGAAACAGTTGGTACATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-471s21c1
Sequence:CCGGTCTTGCTTGTTGGGACCCAAACTCGAGTTTGGGTCCCAACAAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-231s21c1
Sequence:CCGGCGGAATATGTACCAACTGTTTCTCGAGAAACAGTTGGTACATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-347s21c1
Sequence:CCGGCCGCTAAGTTATCCACAGACACTCGAGTGTCTGTGGATAACTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-288s21c1
Sequence:CCGGAGCCATACACTCTTGGACTTTCTCGAGAAAGTCCAAGAGTGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-454s21c1
Sequence:CCGGCTGTCCAAAGACTCCTTTCTTCTCGAGAAGAAAGGAGTCTTTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009861
VALIDATED
CDC42 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 42
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-277s1c1
Sequence:CCGGCCGCTAAGTTATCCACAGACACTCGAGTGTCTGTGGATAACTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-401s1c1
Sequence:CCGGTCTTGCTTGTTGGGACCCAAACTCGAGTTTGGGTCCCAACAAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-384s1c1
Sequence:CCGGCTGTCCAAAGACTCCTTTCTTCTCGAGAAGAAAGGAGTCTTTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-218s1c1
Sequence:CCGGAGCCATACACTCTTGGACTTTCTCGAGAAAGTCCAAGAGTGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009861.1-161s1c1
Sequence:CCGGCGGAATATGTACCAACTGTTTCTCGAGAAACAGTTGGTACATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-471s21c1
Sequence:CCGGTCTTGCTTGTTGGGACCCAAACTCGAGTTTGGGTCCCAACAAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-231s21c1
Sequence:CCGGCGGAATATGTACCAACTGTTTCTCGAGAAACAGTTGGTACATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-347s21c1
Sequence:CCGGCCGCTAAGTTATCCACAGACACTCGAGTGTCTGTGGATAACTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-288s21c1
Sequence:CCGGAGCCATACACTCTTGGACTTTCTCGAGAAAGTCCAAGAGTGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009861.2-454s21c1
Sequence:CCGGCTGTCCAAAGACTCCTTTCTTCTCGAGAAGAAAGGAGTCTTTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks