EMAIL THIS PAGE TO A FRIEND

CDC42BPA

CDC42 binding protein kinase alpha (DMPK-like)

267 Gene Product Result for
Synonyms: MRCK MRCKA PK428
Gene ID:
Human(8476) Summary: The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]
Mouse(226751) CDC42 binding protein kinase alpha
Rat(114116) CDC42 binding protein kinase alpha
Zebrafish(567912) CDC42 binding protein kinase alpha (DMPK-like)
cow(538392) CDC42 binding protein kinase alpha (DMPK-like)
cow(787410) CDC42 binding protein kinase alpha (DMPK-like)
Horse(100054548) CDC42 binding protein kinase alpha (DMPK-like)
domestic cat(101088047) CDC42 binding protein kinase alpha (DMPK-like)
dog(480107) CDC42 binding protein kinase alpha (DMPK-like)
chicken(416746) CDC42 binding protein kinase alpha (DMPK-like)
naked mole-rat(101704231) CDC42 binding protein kinase alpha (DMPK-like)
domestic guinea pig(100732769) CDC42 binding protein kinase alpha (DMPK-like)
sheep(101114291) CDC42 binding protein kinase alpha (DMPK-like)
Domestic Rabbit(100342314) CDC42 binding protein kinase alpha (DMPK-like)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014826 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_283677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158751 MISSION® esiRNA esiRNA human CDC42BPA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003607 Rosetta Predictions human pricing
NM_014826 Rosetta Predictions human pricing
NM_053657 Rosetta Predictions rat pricing
XM_900254 Rosetta Predictions mouse pricing
XM_900280 Rosetta Predictions mouse pricing
XM_900313 Rosetta Predictions mouse pricing
XM_975852 Rosetta Predictions mouse pricing
XM_975917 Rosetta Predictions mouse pricing
XM_975992 Rosetta Predictions mouse pricing
XM_976025 Rosetta Predictions mouse pricing
XM_976101 Rosetta Predictions mouse pricing
XM_976135 Rosetta Predictions mouse pricing
XM_991094 Rosetta Predictions mouse pricing
XM_991179 Rosetta Predictions mouse pricing
XM_991198 Rosetta Predictions mouse pricing
XM_991226 Rosetta Predictions mouse pricing
XM_991276 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041017 predicted 5277
2 SASI_Hs01_00041018 predicted 5830
3 SASI_Hs02_00335942 predicted 4160
4 SASI_Hs01_00041019 predicted 1108
5 SASI_Hs01_00041020 predicted 2183
6 SASI_Hs01_00041021 predicted 5722
7 SASI_Hs01_00041022 predicted 1389
8 SASI_Hs01_00041023 predicted 5822
9 SASI_Hs01_00041025 predicted 4754
10 SASI_Hs01_00041026 predicted 4433
11 SASI_Hs01_00041024 predicted 4830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037104 predicted 5027
2 SASI_Hs01_00037105 predicted 5588
3 SASI_Hs02_00346363 predicted 3916
4 SASI_Hs01_00037106 predicted 1107
5 SASI_Hs01_00037107 predicted 2175
6 SASI_Hs01_00037108 predicted 5470
7 SASI_Hs01_00037109 predicted 1384
8 SASI_Hs01_00037110 predicted 5576
9 SASI_Hs01_00037112 predicted 4516
10 SASI_Hs01_00037113 predicted 4191
11 SASI_Hs01_00037111 predicted 4587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266388 predicted 2923
2 SASI_Rn01_00111690 predicted 1942
3 SASI_Rn01_00111691 predicted 4703
4 SASI_Rn01_00111692 predicted 4285
5 SASI_Rn01_00111693 predicted 975
6 SASI_Rn02_00266389 predicted 1151
7 SASI_Rn01_00111694 predicted 1262
8 SASI_Rn01_00111695 predicted 5339
9 SASI_Rn01_00111696 predicted 3979
10 SASI_Rn01_00111697 predicted 1725
11 SASI_Rn01_00111698 predicted 5465
12 SASI_Rn01_00111699 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259371 predicted 273
2 SASI_Mm01_00259372 predicted 213
3 SASI_Mm01_00259373 predicted 273
4 SASI_Mm01_00259374 predicted 371
5 SASI_Mm01_00259375 predicted 366
6 SASI_Mm01_00259376 predicted 369
7 SASI_Mm01_00259377 predicted 272
8 SASI_Mm01_00259378 predicted 367
9 SASI_Mm01_00259379 predicted 301
10 SASI_Mm01_00259380 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229942 predicted 1443
2 SASI_Mm01_00229943 predicted 1185
3 SASI_Mm01_00229944 predicted 700
4 SASI_Mm01_00229945 predicted 843
5 SASI_Mm01_00229946 predicted 1036
6 SASI_Mm01_00229947 predicted 678
7 SASI_Mm01_00229948 predicted 2072
8 SASI_Mm01_00229949 predicted 1454
9 SASI_Mm01_00229950 predicted 2179
10 SASI_Mm01_00229951 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233639 predicted 1428
2 SASI_Mm01_00233640 predicted 3927
3 SASI_Mm01_00233641 predicted 1746
4 SASI_Mm01_00233642 predicted 1152
5 SASI_Mm01_00233643 predicted 1664
6 SASI_Mm01_00233644 predicted 5296
7 SASI_Mm01_00233645 predicted 2022
8 SASI_Mm01_00233646 predicted 2491
9 SASI_Mm01_00233647 predicted 5406
10 SASI_Mm01_00233648 predicted 2884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445786 predicted 771
2 SASI_Mm02_00445787 predicted 2813
3 SASI_Mm02_00445788 predicted 1090
4 SASI_Mm02_00445789 predicted 499
5 SASI_Mm02_00445790 predicted 1013
6 SASI_Mm02_00445791 predicted 4952
7 SASI_Mm02_00445792 predicted 4332
8 SASI_Mm02_00445793 predicted 2079
9 SASI_Mm02_00445794 predicted 5061
10 SASI_Mm02_00445795 predicted 2472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445805 predicted 779
2 SASI_Mm02_00445806 predicted 2819
3 SASI_Mm02_00445807 predicted 1087
4 SASI_Mm02_00445808 predicted 497
5 SASI_Mm02_00445809 predicted 1012
6 SASI_Mm02_00445810 predicted 4943
7 SASI_Mm02_00445811 predicted 4313
8 SASI_Mm02_00445812 predicted 2078
9 SASI_Mm02_00445813 predicted 5056
10 SASI_Mm02_00445814 predicted 2474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445832 predicted 775
2 SASI_Mm02_00445833 predicted 2573
3 SASI_Mm02_00445834 predicted 1083
4 SASI_Mm02_00445835 predicted 502
5 SASI_Mm02_00445836 predicted 1011
6 SASI_Mm02_00445837 predicted 4591
7 SASI_Mm02_00445838 predicted 3967
8 SASI_Mm02_00445839 predicted 1839
9 SASI_Mm02_00445840 predicted 4708
10 SASI_Mm02_00445841 predicted 2234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445868 predicted 780
2 SASI_Mm02_00445869 predicted 2818
3 SASI_Mm02_00445870 predicted 1090
4 SASI_Mm02_00445871 predicted 502
5 SASI_Mm02_00445872 predicted 1012
6 SASI_Mm02_00445873 predicted 4868
7 SASI_Mm02_00445874 predicted 4251
8 SASI_Mm02_00445875 predicted 2081
9 SASI_Mm02_00445876 predicted 4987
10 SASI_Mm02_00445877 predicted 2474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445878 predicted 779
2 SASI_Mm02_00445879 predicted 2812
3 SASI_Mm02_00445880 predicted 1087
4 SASI_Mm02_00445881 predicted 496
5 SASI_Mm02_00445882 predicted 1014
6 SASI_Mm02_00445883 predicted 4835
7 SASI_Mm02_00445884 predicted 4213
8 SASI_Mm02_00445885 predicted 2080
9 SASI_Mm02_00445886 predicted 4949
10 SASI_Mm02_00445887 predicted 2481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445901 predicted 772
2 SASI_Mm02_00445902 predicted 2946
3 SASI_Mm02_00445903 predicted 1083
4 SASI_Mm02_00445904 predicted 498
5 SASI_Mm02_00445905 predicted 1008
6 SASI_Mm02_00445906 predicted 4885
7 SASI_Mm02_00445907 predicted 4253
8 SASI_Mm02_00445908 predicted 2084
9 SASI_Mm02_00445909 predicted 4998
10 SASI_Mm02_00445910 predicted 2479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202077 predicted 1316
2 SASI_Mm01_00202078 predicted 1432
3 SASI_Mm01_00202079 predicted 1740
4 SASI_Mm01_00202080 predicted 1520
5 SASI_Mm01_00202081 predicted 1153
6 SASI_Mm01_00202082 predicted 1672
7 SASI_Mm01_00202083 predicted 1337
8 SASI_Mm01_00202084 predicted 1482
9 SASI_Mm01_00202085 predicted 2026
10 SASI_Mm01_00202086 predicted 2489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235296 predicted 774
2 SASI_Mm02_00450620 predicted 3704
3 SASI_Mm01_00235298 predicted 1087
4 SASI_Mm01_00235300 predicted 1011
5 SASI_Mm02_00450621 predicted 685
6 SASI_Mm01_00235302 predicted 1369
7 SASI_Mm02_00450622 predicted 3971
8 SASI_Mm01_00235305 predicted 2230
9 SASI_Mm02_00450623 predicted 3948
10 SASI_Mm02_00450624 predicted 3385
11 SASI_Mm01_00235297 predicted 3226
12 SASI_Mm01_00235299 predicted 510
13 SASI_Mm01_00235301 predicted 4600
14 SASI_Mm01_00235303 predicted 1847
15 SASI_Mm01_00235304 predicted 4709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214848 predicted 774
2 SASI_Mm02_00450634 predicted 3977
3 SASI_Mm01_00214850 predicted 1085
4 SASI_Mm01_00214852 predicted 1011
5 SASI_Mm02_00450635 predicted 684
6 SASI_Mm01_00214854 predicted 1363
7 SASI_Mm02_00450636 predicted 4250
8 SASI_Mm01_00214855 predicted 2076
9 SASI_Mm01_00214857 predicted 2479
10 SASI_Mm02_00450637 predicted 4228
11 SASI_Mm01_00214849 predicted 3505
12 SASI_Mm01_00214851 predicted 503
13 SASI_Mm01_00214853 predicted 4873
14 SASI_Mm01_00214856 predicted 4995
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213128 predicted 773
2 SASI_Mm02_00450638 predicted 3945
3 SASI_Mm01_00213130 predicted 1086
4 SASI_Mm01_00213132 predicted 1015
5 SASI_Mm02_00450639 predicted 678
6 SASI_Mm01_00213134 predicted 1371
7 SASI_Mm02_00450640 predicted 4211
8 SASI_Mm01_00213135 predicted 2078
9 SASI_Mm01_00213137 predicted 2477
10 SASI_Mm02_00450641 predicted 4193
11 SASI_Mm01_00213129 predicted 3472
12 SASI_Mm01_00213131 predicted 502
13 SASI_Mm01_00213133 predicted 4841
14 SASI_Mm01_00213136 predicted 4954
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240439 predicted 780
2 SASI_Mm02_00450692 predicted 3986
3 SASI_Mm01_00240441 predicted 1089
4 SASI_Mm01_00240443 predicted 1016
5 SASI_Mm02_00450693 predicted 676
6 SASI_Mm01_00240445 predicted 1366
7 SASI_Mm02_00450694 predicted 4261
8 SASI_Mm01_00240446 predicted 2080
9 SASI_Mm01_00240448 predicted 2477
10 SASI_Mm02_00450695 predicted 4242
11 SASI_Mm01_00240440 predicted 3515
12 SASI_Mm01_00240442 predicted 511
13 SASI_Mm01_00240444 predicted 4882
14 SASI_Mm01_00240447 predicted 4998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033285
VALIDATED
CDC42BPA MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase alpha (DMPK-like)
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033285.1-1111s21c1
Sequence:CCGGAGCCCGACAGATACGTCAAATCTCGAGATTTGACGTATCTGTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033285.1-1965s21c1
Sequence:CCGGCCGAGAGCAGAGCGAACATTACTCGAGTAATGTTCGCTCTGCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033285.1-5478s21c1
Sequence:CCGGAGTAAACCCTCACGAATTAAACTCGAGTTTAATTCGTGAGGGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033285
VALIDATED
CDC42BPA MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase alpha (DMPK-like)
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033285.1-1111s21c1
Sequence:CCGGAGCCCGACAGATACGTCAAATCTCGAGATTTGACGTATCTGTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033285.1-1965s21c1
Sequence:CCGGCCGAGAGCAGAGCGAACATTACTCGAGTAATGTTCGCTCTGCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033285.1-5478s21c1
Sequence:CCGGAGTAAACCCTCACGAATTAAACTCGAGTTTAATTCGTGAGGGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033285
VALIDATED
CDC42BPA MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase alpha (DMPK-like)
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033285.1-1111s21c1
Sequence:CCGGAGCCCGACAGATACGTCAAATCTCGAGATTTGACGTATCTGTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033285.1-1965s21c1
Sequence:CCGGCCGAGAGCAGAGCGAACATTACTCGAGTAATGTTCGCTCTGCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033285.1-5478s21c1
Sequence:CCGGAGTAAACCCTCACGAATTAAACTCGAGTTTAATTCGTGAGGGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003607
CDC42BPA MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase alpha (DMPK-like)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-2732s1c1
Sequence:CCGGGCTCGCCATGTCCGAGATAAGCTCGAGCTTATCTCGGACATGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.2-1974s1c1
Sequence:CCGGGTGGAATTGATTGGGATAATACTCGAGTATTATCCCAATCAATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-5268s1c1
Sequence:CCGGGTTGTTACAATGCACCATATCCTCGAGGATATGGTGCATTGTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003607.2-7556s1c1
Sequence:CCGGGCAGAATCAGAAGGATCTATTCTCGAGAATAGATCCTTCTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.2-2599s1c1
Sequence:CCGGCCAGGCTAGTGAGCGATTAAACTCGAGTTTAATCGCTCACTAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-3825s1c1
Sequence:CCGGCCGATGCTCTGGATCAATTTGCTCGAGCAAATTGATCCAGAGCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.2-4370s1c1
Sequence:CCGGCGGAAAGATATACCCTGTATACTCGAGTATACAGGGTATATCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003607.2-7581s1c1
Sequence:CCGGCAGAATCATTTCACCAGTTAACTCGAGTTAACTGGTGAAATGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-3338s1c1
Sequence:CCGGCAGTTAGAAGAAGAGGTTAAACTCGAGTTTAACCTCTTCTTCTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-5733s1c1
Sequence:CCGGGCTCAGTCAGTATTCCATCTACTCGAGTAGATGGAATACTGACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-2992s1c1
Sequence:CCGGGCAAGAGATAACCAAACTAAACTCGAGTTTAGTTTGGTTATCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-4535s1c1
Sequence:CCGGCGCTCAGTCTATGTTCCCAAACTCGAGTTTGGGAACATAGACTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-1153s1c1
Sequence:CCGGGCGATTACATAGAGAAGACTTCTCGAGAAGTCTTCTCTATGTAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003607.x-7066s1c1
Sequence:CCGGCCGCAGATAAATGTAGAAATACTCGAGTATTTCTACATTTATCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003607
CDC42BPA MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase alpha (DMPK-like)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-2732s1c1
Sequence:CCGGGCTCGCCATGTCCGAGATAAGCTCGAGCTTATCTCGGACATGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.2-1974s1c1
Sequence:CCGGGTGGAATTGATTGGGATAATACTCGAGTATTATCCCAATCAATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-5268s1c1
Sequence:CCGGGTTGTTACAATGCACCATATCCTCGAGGATATGGTGCATTGTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003607.2-7556s1c1
Sequence:CCGGGCAGAATCAGAAGGATCTATTCTCGAGAATAGATCCTTCTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.2-2599s1c1
Sequence:CCGGCCAGGCTAGTGAGCGATTAAACTCGAGTTTAATCGCTCACTAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-3825s1c1
Sequence:CCGGCCGATGCTCTGGATCAATTTGCTCGAGCAAATTGATCCAGAGCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.2-4370s1c1
Sequence:CCGGCGGAAAGATATACCCTGTATACTCGAGTATACAGGGTATATCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003607.2-7581s1c1
Sequence:CCGGCAGAATCATTTCACCAGTTAACTCGAGTTAACTGGTGAAATGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-3338s1c1
Sequence:CCGGCAGTTAGAAGAAGAGGTTAAACTCGAGTTTAACCTCTTCTTCTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-5733s1c1
Sequence:CCGGGCTCAGTCAGTATTCCATCTACTCGAGTAGATGGAATACTGACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-2992s1c1
Sequence:CCGGGCAAGAGATAACCAAACTAAACTCGAGTTTAGTTTGGTTATCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-4535s1c1
Sequence:CCGGCGCTCAGTCTATGTTCCCAAACTCGAGTTTGGGAACATAGACTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-1153s1c1
Sequence:CCGGGCGATTACATAGAGAAGACTTCTCGAGAAGTCTTCTCTATGTAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003607.x-7066s1c1
Sequence:CCGGCCGCAGATAAATGTAGAAATACTCGAGTATTTCTACATTTATCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003607
CDC42BPA MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase alpha (DMPK-like)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-2732s1c1
Sequence:CCGGGCTCGCCATGTCCGAGATAAGCTCGAGCTTATCTCGGACATGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.2-1974s1c1
Sequence:CCGGGTGGAATTGATTGGGATAATACTCGAGTATTATCCCAATCAATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-5268s1c1
Sequence:CCGGGTTGTTACAATGCACCATATCCTCGAGGATATGGTGCATTGTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003607.2-7556s1c1
Sequence:CCGGGCAGAATCAGAAGGATCTATTCTCGAGAATAGATCCTTCTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.2-2599s1c1
Sequence:CCGGCCAGGCTAGTGAGCGATTAAACTCGAGTTTAATCGCTCACTAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-3825s1c1
Sequence:CCGGCCGATGCTCTGGATCAATTTGCTCGAGCAAATTGATCCAGAGCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.2-4370s1c1
Sequence:CCGGCGGAAAGATATACCCTGTATACTCGAGTATACAGGGTATATCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003607.2-7581s1c1
Sequence:CCGGCAGAATCATTTCACCAGTTAACTCGAGTTAACTGGTGAAATGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003607.2-3338s1c1
Sequence:CCGGCAGTTAGAAGAAGAGGTTAAACTCGAGTTTAACCTCTTCTTCTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-5733s1c1
Sequence:CCGGGCTCAGTCAGTATTCCATCTACTCGAGTAGATGGAATACTGACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-2992s1c1
Sequence:CCGGGCAAGAGATAACCAAACTAAACTCGAGTTTAGTTTGGTTATCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-4535s1c1
Sequence:CCGGCGCTCAGTCTATGTTCCCAAACTCGAGTTTGGGAACATAGACTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003607.x-1153s1c1
Sequence:CCGGGCGATTACATAGAGAAGACTTCTCGAGAAGTCTTCTCTATGTAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003607.x-7066s1c1
Sequence:CCGGCCGCAGATAAATGTAGAAATACTCGAGTATTTCTACATTTATCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014826
VALIDATED
CDC42BPA MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase alpha (DMPK-like)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014826.x-1153s1c1
Sequence:CCGGGCGATTACATAGAGAAGACTTCTCGAGAAGTCTTCTCTATGTAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014826.x-5490s1c1
Sequence:CCGGGCTCAGTCAGTATTCCATCTACTCGAGTAGATGGAATACTGACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014826.x-6823s1c1
Sequence:CCGGCCGCAGATAAATGTAGAAATACTCGAGTATTTCTACATTTATCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014826.x-2749s1c1
Sequence:CCGGGCAAGAGATAACCAAACTAAACTCGAGTTTAGTTTGGTTATCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014826.x-4292s1c1
Sequence:CCGGCGCTCAGTCTATGTTCCCAAACTCGAGTTTGGGAACATAGACTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014826
VALIDATED
CDC42BPA MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase alpha (DMPK-like)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014826.x-1153s1c1
Sequence:CCGGGCGATTACATAGAGAAGACTTCTCGAGAAGTCTTCTCTATGTAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014826.x-5490s1c1
Sequence:CCGGGCTCAGTCAGTATTCCATCTACTCGAGTAGATGGAATACTGACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014826.x-6823s1c1
Sequence:CCGGCCGCAGATAAATGTAGAAATACTCGAGTATTTCTACATTTATCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014826.x-2749s1c1
Sequence:CCGGGCAAGAGATAACCAAACTAAACTCGAGTTTAGTTTGGTTATCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014826.x-4292s1c1
Sequence:CCGGCGCTCAGTCTATGTTCCCAAACTCGAGTTTGGGAACATAGACTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014826
VALIDATED
CDC42BPA MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase alpha (DMPK-like)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014826.x-1153s1c1
Sequence:CCGGGCGATTACATAGAGAAGACTTCTCGAGAAGTCTTCTCTATGTAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014826.x-5490s1c1
Sequence:CCGGGCTCAGTCAGTATTCCATCTACTCGAGTAGATGGAATACTGACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014826.x-6823s1c1
Sequence:CCGGCCGCAGATAAATGTAGAAATACTCGAGTATTTCTACATTTATCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014826.x-2749s1c1
Sequence:CCGGGCAAGAGATAACCAAACTAAACTCGAGTTTAGTTTGGTTATCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014826.x-4292s1c1
Sequence:CCGGCGCTCAGTCTATGTTCCCAAACTCGAGTTTGGGAACATAGACTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283677
VALIDATED
CDC42BPA MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase alpha (DMPK-like)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000022681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283677.2-2083s1c1
Sequence:CCGGGCATCTAACATCTTAACAGAACTCGAGTTCTGTTAAGATGTTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283677.2-436s1c1
Sequence:CCGGGCACCTTACATCCCAGAAGTTCTCGAGAACTTCTGGGATGTAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283677.2-3025s1c1
Sequence:CCGGGCCGCTGCAATCATAGATCATCTCGAGATGATCTATGATTGCAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283677.2-3378s1c1
Sequence:CCGGGCACAGGAAGTTTAAGGAGATCTCGAGATCTCCTTAAACTTCCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283677
VALIDATED
CDC42BPA MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase alpha (DMPK-like)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000022681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283677.2-2083s1c1
Sequence:CCGGGCATCTAACATCTTAACAGAACTCGAGTTCTGTTAAGATGTTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283677.2-436s1c1
Sequence:CCGGGCACCTTACATCCCAGAAGTTCTCGAGAACTTCTGGGATGTAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283677.2-3025s1c1
Sequence:CCGGGCCGCTGCAATCATAGATCATCTCGAGATGATCTATGATTGCAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283677.2-3378s1c1
Sequence:CCGGGCACAGGAAGTTTAAGGAGATCTCGAGATCTCCTTAAACTTCCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283677
VALIDATED
CDC42BPA MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase alpha (DMPK-like)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000022681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283677.2-2083s1c1
Sequence:CCGGGCATCTAACATCTTAACAGAACTCGAGTTCTGTTAAGATGTTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283677.2-436s1c1
Sequence:CCGGGCACCTTACATCCCAGAAGTTCTCGAGAACTTCTGGGATGTAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283677.2-3025s1c1
Sequence:CCGGGCCGCTGCAATCATAGATCATCTCGAGATGATCTATGATTGCAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283677.2-3378s1c1
Sequence:CCGGGCACAGGAAGTTTAAGGAGATCTCGAGATCTCCTTAAACTTCCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks