EMAIL THIS PAGE TO A FRIEND

CDC42BPB

CDC42 binding protein kinase beta (DMPK-like)

80 Gene Product Result for
Synonyms: MRCKB
UniProtKB ID: Q9Y5S2, Q2L7A5, Q86TJ1, Q9ULU5
Gene ID:
Human(9578) Summary: This gene encodes a member of the serine/threonine protein kinase family. The encoded protein contains a Cdc42/Rac-binding p21 binding domain resembling that of PAK kinase. The kinase domain of this protein is most closely related to that of myotonic dystrophy kinase-related ROK. Studies of the similar gene in rat suggested that this kinase may act as a downstream effector of Cdc42 in cytoskeletal reorganization. [provided by RefSeq, Jul 2008]
Mouse(217866) CDC42 binding protein kinase beta
Rat(113960) CDC42 binding protein kinase beta (DMPK-like)
sheep(101122467) CDC42 binding protein kinase beta (DMPK-like)
domestic guinea pig(100734962) CDC42 binding protein kinase beta (DMPK-like)
naked mole-rat(101717464) CDC42 binding protein kinase beta (DMPK-like)
Zebrafish(567039) CDC42 binding protein kinase beta (DMPK-like)
chicken(423473) CDC42 binding protein kinase beta (DMPK-like)
cow(508226) CDC42 binding protein kinase beta (DMPK-like)
Horse(100058888) CDC42 binding protein kinase beta (DMPK-like)
domestic cat(101084370) CDC42 binding protein kinase beta (DMPK-like)
dog(490868) CDC42 binding protein kinase beta (DMPK-like)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006035 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006035 Rosetta Predictions human pricing
NM_053620 Rosetta Predictions rat pricing
NM_183016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036586 predicted 1283
2 SASI_Hs01_00036587 predicted 994
3 SASI_Hs01_00036588 predicted 879
4 SASI_Hs02_00340770 predicted 3581
5 SASI_Hs01_00036590 predicted 525
6 SASI_Hs02_00340771 predicted 1467
7 SASI_Hs01_00036591 predicted 4000
8 SASI_Hs01_00036592 predicted 754
9 SASI_Hs01_00036593 predicted 4563
10 SASI_Hs01_00036595 predicted 3736
11 SASI_Hs01_00036589 predicted 3575
12 SASI_Hs01_00036594 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052480 predicted 2600
2 SASI_Rn01_00052481 predicted 3380
3 SASI_Rn01_00052482 predicted 376
4 SASI_Rn01_00052483 predicted 1338
5 SASI_Rn02_00266325 predicted 732
6 SASI_Rn01_00052484 predicted 2918
7 SASI_Rn01_00052485 predicted 605
8 SASI_Rn01_00052486 predicted 4594
9 SASI_Rn01_00052487 predicted 849
10 SASI_Rn02_00266326 predicted 806
11 SASI_Rn01_00052488 predicted 375
12 SASI_Rn01_00052489 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173256 predicted 2917
2 SASI_Mm01_00173257 predicted 736
3 SASI_Mm02_00350020 predicted 5318
4 SASI_Mm01_00173259 predicted 4138
5 SASI_Mm01_00173260 predicted 502
6 SASI_Mm01_00173261 predicted 2596
7 SASI_Mm01_00173262 predicted 752
8 SASI_Mm01_00173263 predicted 854
9 SASI_Mm01_00173264 predicted 3923
10 SASI_Mm01_00173265 predicted 4592
11 SASI_Mm01_00173258 predicted 2933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183016
VALIDATED
CDC42BPB MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase beta (DMPK-like)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183016.1-2929s1c1
Sequence:CCGGCCAGGATTCTATCTTTGAGTACTCGAGTACTCAAAGATAGAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183016.1-3573s1c1
Sequence:CCGGCCTCAGATGTTATCCATGCTACTCGAGTAGCATGGATAACATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183016.1-1751s1c1
Sequence:CCGGCGATTGAAATCCCAGACCAAACTCGAGTTTGGTCTGGGATTTCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183016.1-372s21c1
Sequence:CCGGTGAGGAACACTGAACGAATTTCTCGAGAAATTCGTTCAGTGTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183016.1-3598s21c1
Sequence:CCGGCCGAGACATTCCGTGCATATTCTCGAGAATATGCACGGAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183016.1-2933s21c1
Sequence:CCGGGATTCTATCTTTGAGTATTTCCTCGAGGAAATACTCAAAGATAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183016.1-1032s21c1
Sequence:CCGGACCTTATCCAGAGACTAATATCTCGAGATATTAGTCTCTGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183016
VALIDATED
CDC42BPB MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase beta (DMPK-like)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183016.1-2929s1c1
Sequence:CCGGCCAGGATTCTATCTTTGAGTACTCGAGTACTCAAAGATAGAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183016.1-3573s1c1
Sequence:CCGGCCTCAGATGTTATCCATGCTACTCGAGTAGCATGGATAACATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183016.1-1751s1c1
Sequence:CCGGCGATTGAAATCCCAGACCAAACTCGAGTTTGGTCTGGGATTTCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183016.1-372s21c1
Sequence:CCGGTGAGGAACACTGAACGAATTTCTCGAGAAATTCGTTCAGTGTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183016.1-3598s21c1
Sequence:CCGGCCGAGACATTCCGTGCATATTCTCGAGAATATGCACGGAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183016.1-2933s21c1
Sequence:CCGGGATTCTATCTTTGAGTATTTCCTCGAGGAAATACTCAAAGATAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183016.1-1032s21c1
Sequence:CCGGACCTTATCCAGAGACTAATATCTCGAGATATTAGTCTCTGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183016
VALIDATED
CDC42BPB MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase beta (DMPK-like)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183016.1-2929s1c1
Sequence:CCGGCCAGGATTCTATCTTTGAGTACTCGAGTACTCAAAGATAGAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183016.1-3573s1c1
Sequence:CCGGCCTCAGATGTTATCCATGCTACTCGAGTAGCATGGATAACATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183016.1-1751s1c1
Sequence:CCGGCGATTGAAATCCCAGACCAAACTCGAGTTTGGTCTGGGATTTCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183016.1-372s21c1
Sequence:CCGGTGAGGAACACTGAACGAATTTCTCGAGAAATTCGTTCAGTGTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183016.1-3598s21c1
Sequence:CCGGCCGAGACATTCCGTGCATATTCTCGAGAATATGCACGGAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183016.1-2933s21c1
Sequence:CCGGGATTCTATCTTTGAGTATTTCCTCGAGGAAATACTCAAAGATAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183016.1-1032s21c1
Sequence:CCGGACCTTATCCAGAGACTAATATCTCGAGATATTAGTCTCTGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006035
VALIDATED
CDC42BPB MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase beta (DMPK-like)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-749s1c1
Sequence:CCGGGATTACTATGTGGGTGGTGATCTCGAGATCACCACCCACATAGTAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-1546s1c1
Sequence:CCGGGCAGTCCAACACATTAACCAACTCGAGTTGGTTAATGTGTTGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-1723s1c1
Sequence:CCGGCAGCAATTCAAACCGAGATAACTCGAGTTATCTCGGTTTGAATTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006035.x-5307s1c1
Sequence:CCGGCCACCAAACACTCAACTCCATCTCGAGATGGAGTTGAGTGTTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-6389s1c1
Sequence:CCGGTCACCCTTTGTACCAGATGTTCTCGAGAACATCTGGTACAAAGGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006035.2-2543s1c1
Sequence:CCGGGAGGAGGCAGTAGGTACAATACTCGAGTATTGTACCTACTGCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.2-773s1c1
Sequence:CCGGCTGACCCTGCTCAGCAAATTTCTCGAGAAATTTGCTGAGCAGGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006035.2-4151s1c1
Sequence:CCGGCCCAGGGAGAAGATCGTAATCCTCGAGGATTACGATCTTCTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006035.2-734s1c1
Sequence:CCGGCTGTACTTAGTCATGGATTACCTCGAGGTAATCCATGACTAAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.2-4378s1c1
Sequence:CCGGCCACAGAAAGTTCAATGAGATCTCGAGATCTCATTGAACTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.2-818s1c1
Sequence:CCGGGCGAGGTTCTACATTGGTGAACTCGAGTTCACCAATGTAGAACCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006035.2-3195s1c1
Sequence:CCGGGCTCAGCTAGTGAGCAAGAAACTCGAGTTTCTTGCTCACTAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-1666s21c1
Sequence:CCGGCAGCAATTCAAACCGAGATAACTCGAGTTATCTCGGTTTGAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-1489s21c1
Sequence:CCGGGCAGTCCAACACATTAACCAACTCGAGTTGGTTAATGTGTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-4321s21c1
Sequence:CCGGCCACAGAAAGTTCAATGAGATCTCGAGATCTCATTGAACTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-2486s21c1
Sequence:CCGGGAGGAGGCAGTAGGTACAATACTCGAGTATTGTACCTACTGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006035
VALIDATED
CDC42BPB MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase beta (DMPK-like)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-749s1c1
Sequence:CCGGGATTACTATGTGGGTGGTGATCTCGAGATCACCACCCACATAGTAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-1546s1c1
Sequence:CCGGGCAGTCCAACACATTAACCAACTCGAGTTGGTTAATGTGTTGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-1723s1c1
Sequence:CCGGCAGCAATTCAAACCGAGATAACTCGAGTTATCTCGGTTTGAATTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006035.x-5307s1c1
Sequence:CCGGCCACCAAACACTCAACTCCATCTCGAGATGGAGTTGAGTGTTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-6389s1c1
Sequence:CCGGTCACCCTTTGTACCAGATGTTCTCGAGAACATCTGGTACAAAGGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006035.2-2543s1c1
Sequence:CCGGGAGGAGGCAGTAGGTACAATACTCGAGTATTGTACCTACTGCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.2-773s1c1
Sequence:CCGGCTGACCCTGCTCAGCAAATTTCTCGAGAAATTTGCTGAGCAGGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006035.2-4151s1c1
Sequence:CCGGCCCAGGGAGAAGATCGTAATCCTCGAGGATTACGATCTTCTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006035.2-734s1c1
Sequence:CCGGCTGTACTTAGTCATGGATTACCTCGAGGTAATCCATGACTAAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.2-4378s1c1
Sequence:CCGGCCACAGAAAGTTCAATGAGATCTCGAGATCTCATTGAACTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.2-818s1c1
Sequence:CCGGGCGAGGTTCTACATTGGTGAACTCGAGTTCACCAATGTAGAACCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006035.2-3195s1c1
Sequence:CCGGGCTCAGCTAGTGAGCAAGAAACTCGAGTTTCTTGCTCACTAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-1666s21c1
Sequence:CCGGCAGCAATTCAAACCGAGATAACTCGAGTTATCTCGGTTTGAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-1489s21c1
Sequence:CCGGGCAGTCCAACACATTAACCAACTCGAGTTGGTTAATGTGTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-4321s21c1
Sequence:CCGGCCACAGAAAGTTCAATGAGATCTCGAGATCTCATTGAACTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-2486s21c1
Sequence:CCGGGAGGAGGCAGTAGGTACAATACTCGAGTATTGTACCTACTGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006035
VALIDATED
CDC42BPB MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase beta (DMPK-like)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-749s1c1
Sequence:CCGGGATTACTATGTGGGTGGTGATCTCGAGATCACCACCCACATAGTAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-1546s1c1
Sequence:CCGGGCAGTCCAACACATTAACCAACTCGAGTTGGTTAATGTGTTGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-1723s1c1
Sequence:CCGGCAGCAATTCAAACCGAGATAACTCGAGTTATCTCGGTTTGAATTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006035.x-5307s1c1
Sequence:CCGGCCACCAAACACTCAACTCCATCTCGAGATGGAGTTGAGTGTTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.x-6389s1c1
Sequence:CCGGTCACCCTTTGTACCAGATGTTCTCGAGAACATCTGGTACAAAGGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006035.2-2543s1c1
Sequence:CCGGGAGGAGGCAGTAGGTACAATACTCGAGTATTGTACCTACTGCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.2-773s1c1
Sequence:CCGGCTGACCCTGCTCAGCAAATTTCTCGAGAAATTTGCTGAGCAGGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006035.2-4151s1c1
Sequence:CCGGCCCAGGGAGAAGATCGTAATCCTCGAGGATTACGATCTTCTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006035.2-734s1c1
Sequence:CCGGCTGTACTTAGTCATGGATTACCTCGAGGTAATCCATGACTAAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.2-4378s1c1
Sequence:CCGGCCACAGAAAGTTCAATGAGATCTCGAGATCTCATTGAACTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006035.2-818s1c1
Sequence:CCGGGCGAGGTTCTACATTGGTGAACTCGAGTTCACCAATGTAGAACCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006035.2-3195s1c1
Sequence:CCGGGCTCAGCTAGTGAGCAAGAAACTCGAGTTTCTTGCTCACTAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-1666s21c1
Sequence:CCGGCAGCAATTCAAACCGAGATAACTCGAGTTATCTCGGTTTGAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-1489s21c1
Sequence:CCGGGCAGTCCAACACATTAACCAACTCGAGTTGGTTAATGTGTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-4321s21c1
Sequence:CCGGCCACAGAAAGTTCAATGAGATCTCGAGATCTCATTGAACTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006035.3-2486s21c1
Sequence:CCGGGAGGAGGCAGTAGGTACAATACTCGAGTATTGTACCTACTGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks