EMAIL THIS PAGE TO A FRIEND

CDC42BPG

CDC42 binding protein kinase gamma (DMPK-like)

74 Gene Product Result for
Synonyms: DMPK2 HSMDPKIN KAPPA-200 MRCKG MRCKgamma
UniProtKB ID: Q6DT37, O00565
Gene ID:
Mouse(240505) CDC42 binding protein kinase gamma (DMPK-like)
Rat(293693) CDC42 binding protein kinase gamma (DMPK-like)
cow(518121) CDC42 binding protein kinase gamma (DMPK-like)
domestic cat(101094954) CDC42 binding protein kinase gamma (DMPK-like)
dog(483757) CDC42 binding protein kinase gamma (DMPK-like)
naked mole-rat(101709028) CDC42 binding protein kinase gamma (DMPK-like)
domestic guinea pig(100736108) CDC42 binding protein kinase gamma (DMPK-like)
sheep(101118650) CDC42 binding protein kinase gamma (DMPK-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017525 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_140553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_140553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_140553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_290516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290516 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017525 Rosetta Predictions human pricing
NM_001130013 Rosetta Predictions rat pricing
XM_140553 Rosetta Predictions mouse pricing
XM_906449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350147 predicted 4699
2 SASI_Hs01_00147542 predicted 1166
3 SASI_Hs01_00147543 predicted 2713
4 SASI_Hs01_00147544 predicted 821
5 SASI_Hs01_00147545 predicted 2616
6 SASI_Hs01_00147546 predicted 3737
7 SASI_Hs01_00147547 predicted 851
8 SASI_Hs01_00147548 predicted 3887
9 SASI_Hs01_00147549 predicted 4314
10 SASI_Hs01_00147550 predicted 1394
11 SASI_Hs01_00147551 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255269 predicted 443
2 SASI_Rn02_00255270 predicted 3152
3 SASI_Rn02_00255271 predicted 4231
4 SASI_Rn02_00255272 predicted 3838
5 SASI_Rn02_00255273 predicted 3369
6 SASI_Rn02_00255274 predicted 1461
7 SASI_Rn02_00255275 predicted 3292
8 SASI_Rn02_00255276 predicted 963
9 SASI_Rn02_00255277 predicted 2992
10 SASI_Rn02_00255278 predicted 1977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279119 predicted 2876
2 SASI_Mm02_00424966 predicted 4745
3 SASI_Mm01_00279120 predicted 405
4 SASI_Mm01_00279121 predicted 3850
5 SASI_Mm01_00279122 predicted 4403
6 SASI_Mm01_00279123 predicted 4245
7 SASI_Mm02_00424967 predicted 4777
8 SASI_Mm01_00279124 predicted 796
9 SASI_Mm01_00279125 predicted 4245
10 SASI_Mm02_00424968 predicted 4790
11 SASI_Mm01_00279118 predicted 4489
12 SASI_Mm01_00279126 predicted 3501
13 SASI_Mm01_00279127 predicted 4276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432523 predicted 2874
2 SASI_Mm02_00432524 predicted 4737
3 SASI_Mm02_00432525 predicted 404
4 SASI_Mm02_00432526 predicted 3849
5 SASI_Mm02_00432527 predicted 4402
6 SASI_Mm02_00432528 predicted 4235
7 SASI_Mm02_00432529 predicted 4766
8 SASI_Mm02_00432530 predicted 783
9 SASI_Mm02_00432531 predicted 4232
10 SASI_Mm02_00432532 predicted 4782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033342
CDC42BPG MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase gamma (DMPK-like)
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000378360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033342.1-4997s21c1
Sequence:CCGGGGTCCGGGATGTGCTGAAATTCTCGAGAATTTCAGCACATCCCGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033342.1-693s21c1
Sequence:CCGGACCTGGTGATGGACTACTATGCTCGAGCATAGTAGTCCATCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033342.1-4959s21c1
Sequence:CCGGGAGGAAGCAAAGAGCTTATAGCTCGAGCTATAAGCTCTTTGCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033342
CDC42BPG MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase gamma (DMPK-like)
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000378360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033342.1-4997s21c1
Sequence:CCGGGGTCCGGGATGTGCTGAAATTCTCGAGAATTTCAGCACATCCCGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033342.1-693s21c1
Sequence:CCGGACCTGGTGATGGACTACTATGCTCGAGCATAGTAGTCCATCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033342.1-4959s21c1
Sequence:CCGGGAGGAAGCAAAGAGCTTATAGCTCGAGCTATAAGCTCTTTGCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033342
CDC42BPG MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase gamma (DMPK-like)
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000378360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033342.1-4997s21c1
Sequence:CCGGGGTCCGGGATGTGCTGAAATTCTCGAGAATTTCAGCACATCCCGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033342.1-693s21c1
Sequence:CCGGACCTGGTGATGGACTACTATGCTCGAGCATAGTAGTCCATCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033342.1-4959s21c1
Sequence:CCGGGAGGAAGCAAAGAGCTTATAGCTCGAGCTATAAGCTCTTTGCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017525
CDC42BPG MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase gamma (DMPK-like)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-167s21c1
Sequence:CCGGCCTTCGTATCAAAGGTGAAAGCTCGAGCTTTCACCTTTGATACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-1076s21c1
Sequence:CCGGCCATGGACACCTCCAACTTTGCTCGAGCAAAGTTGGAGGTGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-693s21c1
Sequence:CCGGAGTAGGGACGCCGGACTATATCTCGAGATATAGTCCGGCGTCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-3030s21c1
Sequence:CCGGTGTCCTGGCCTCTGATGTTATCTCGAGATAACATCAGAGGCCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017525.1-2421s1c1
Sequence:CCGGGCCCTCAAACTCCCTGATTCCCTCGAGGGAATCAGGGAGTTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017525.1-783s1c1
Sequence:CCGGGCTTGGAGTCTGCGCCTATGACTCGAGTCATAGGCGCAGACTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017525.1-2057s1c1
Sequence:CCGGGCTGGGTGAATGATGAGAAGGCTCGAGCCTTCTCATCATTCACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017525
CDC42BPG MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase gamma (DMPK-like)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-167s21c1
Sequence:CCGGCCTTCGTATCAAAGGTGAAAGCTCGAGCTTTCACCTTTGATACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-1076s21c1
Sequence:CCGGCCATGGACACCTCCAACTTTGCTCGAGCAAAGTTGGAGGTGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-693s21c1
Sequence:CCGGAGTAGGGACGCCGGACTATATCTCGAGATATAGTCCGGCGTCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-3030s21c1
Sequence:CCGGTGTCCTGGCCTCTGATGTTATCTCGAGATAACATCAGAGGCCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017525.1-2421s1c1
Sequence:CCGGGCCCTCAAACTCCCTGATTCCCTCGAGGGAATCAGGGAGTTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017525.1-783s1c1
Sequence:CCGGGCTTGGAGTCTGCGCCTATGACTCGAGTCATAGGCGCAGACTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017525.1-2057s1c1
Sequence:CCGGGCTGGGTGAATGATGAGAAGGCTCGAGCCTTCTCATCATTCACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017525
CDC42BPG MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase gamma (DMPK-like)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-167s21c1
Sequence:CCGGCCTTCGTATCAAAGGTGAAAGCTCGAGCTTTCACCTTTGATACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-1076s21c1
Sequence:CCGGCCATGGACACCTCCAACTTTGCTCGAGCAAAGTTGGAGGTGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-693s21c1
Sequence:CCGGAGTAGGGACGCCGGACTATATCTCGAGATATAGTCCGGCGTCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017525.2-3030s21c1
Sequence:CCGGTGTCCTGGCCTCTGATGTTATCTCGAGATAACATCAGAGGCCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017525.1-2421s1c1
Sequence:CCGGGCCCTCAAACTCCCTGATTCCCTCGAGGGAATCAGGGAGTTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017525.1-783s1c1
Sequence:CCGGGCTTGGAGTCTGCGCCTATGACTCGAGTCATAGGCGCAGACTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017525.1-2057s1c1
Sequence:CCGGGCTGGGTGAATGATGAGAAGGCTCGAGCCTTCTCATCATTCACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_140553
VALIDATED
CDC42BPG MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase gamma (DMPK-like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-804s1c1
Sequence:CCGGCGTGGATGATGATACCCTCAACTCGAGTTGAGGGTATCATCATCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-2441s1c1
Sequence:CCGGGCTACTTCTGTCACTCAGCTTCTCGAGAAGCTGAGTGACAGAAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140553.3-4210s1c1
Sequence:CCGGGACCCATTAGTGAAGAGGAAACTCGAGTTTCCTCTTCACTAATGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-3671s1c1
Sequence:CCGGGTTACACAGCACCCTACCTAACTCGAGTTAGGTAGGGTGCTGTGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-120s1c1
Sequence:CCGGCCAGGATGAAGAGTACCTGTACTCGAGTACAGGTACTCTTCATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_140553
VALIDATED
CDC42BPG MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase gamma (DMPK-like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-804s1c1
Sequence:CCGGCGTGGATGATGATACCCTCAACTCGAGTTGAGGGTATCATCATCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-2441s1c1
Sequence:CCGGGCTACTTCTGTCACTCAGCTTCTCGAGAAGCTGAGTGACAGAAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140553.3-4210s1c1
Sequence:CCGGGACCCATTAGTGAAGAGGAAACTCGAGTTTCCTCTTCACTAATGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-3671s1c1
Sequence:CCGGGTTACACAGCACCCTACCTAACTCGAGTTAGGTAGGGTGCTGTGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-120s1c1
Sequence:CCGGCCAGGATGAAGAGTACCTGTACTCGAGTACAGGTACTCTTCATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_140553
VALIDATED
CDC42BPG MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase gamma (DMPK-like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-804s1c1
Sequence:CCGGCGTGGATGATGATACCCTCAACTCGAGTTGAGGGTATCATCATCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-2441s1c1
Sequence:CCGGGCTACTTCTGTCACTCAGCTTCTCGAGAAGCTGAGTGACAGAAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140553.3-4210s1c1
Sequence:CCGGGACCCATTAGTGAAGAGGAAACTCGAGTTTCCTCTTCACTAATGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-3671s1c1
Sequence:CCGGGTTACACAGCACCCTACCTAACTCGAGTTAGGTAGGGTGCTGTGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140553.3-120s1c1
Sequence:CCGGCCAGGATGAAGAGTACCTGTACTCGAGTACAGGTACTCTTCATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290516
CDC42BPG MISSION shRNA Bacterial Glycerol Stock
CDC42 binding protein kinase gamma (DMPK-like)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-3063s1c1
Sequence:CCGGGTACACACTCAAGGAGGCTTACTCGAGTAAGCCTCCTTGAGTGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-2903s1c1
Sequence:CCGGCACGCATCTTTAGGGTGACAACTCGAGTTGTCACCCTAAAGATGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-166s1c1
Sequence:CCGGCCCTTCGTATCAAAGGTGAAACTCGAGTTTCACCTTTGATACGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-4147s1c1
Sequence:CCGGCCTACCAACTTCAACCACCTACTCGAGTAGGTGGTTGAAGTTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_290516.5-4703s1c1
Sequence:CCGGGCCTTTCTAAGCCATTGGGAACTCGAGTTCCCAATGGCTTAGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290516
CDC42BPG MISSION shRNA shRNA Plasmid DNA
CDC42 binding protein kinase gamma (DMPK-like)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-3063s1c1
Sequence:CCGGGTACACACTCAAGGAGGCTTACTCGAGTAAGCCTCCTTGAGTGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-2903s1c1
Sequence:CCGGCACGCATCTTTAGGGTGACAACTCGAGTTGTCACCCTAAAGATGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-166s1c1
Sequence:CCGGCCCTTCGTATCAAAGGTGAAACTCGAGTTTCACCTTTGATACGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-4147s1c1
Sequence:CCGGCCTACCAACTTCAACCACCTACTCGAGTAGGTGGTTGAAGTTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_290516.5-4703s1c1
Sequence:CCGGGCCTTTCTAAGCCATTGGGAACTCGAGTTCCCAATGGCTTAGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290516
CDC42BPG MISSION shRNA Lentiviral Transduction Particles
CDC42 binding protein kinase gamma (DMPK-like)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-3063s1c1
Sequence:CCGGGTACACACTCAAGGAGGCTTACTCGAGTAAGCCTCCTTGAGTGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-2903s1c1
Sequence:CCGGCACGCATCTTTAGGGTGACAACTCGAGTTGTCACCCTAAAGATGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-166s1c1
Sequence:CCGGCCCTTCGTATCAAAGGTGAAACTCGAGTTTCACCTTTGATACGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290516.5-4147s1c1
Sequence:CCGGCCTACCAACTTCAACCACCTACTCGAGTAGGTGGTTGAAGTTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_290516.5-4703s1c1
Sequence:CCGGGCCTTTCTAAGCCATTGGGAACTCGAGTTCCCAATGGCTTAGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks