EMAIL THIS PAGE TO A FRIEND

CDC42EP1

CDC42 effector protein (Rho GTPase binding) 1

60 Gene Product Result for
Synonyms: BORG5 CEP1 MSE55
UniProtKB ID: Q00587, A8K825, Q96GN1
Gene ID:
Human(11135) Summary: CDC42 is a member of the Rho GTPase family that regulates multiple cellular activities, including actin polymerization. The protein encoded by this gene is a CDC42 binding protein that mediates actin cytoskeleton reorganization at the plasma membrane. This protein is secreted and is primarily found in bone marrow. [provided by RefSeq, Jul 2008]
Mouse(104445) CDC42 effector protein (Rho GTPase binding) 1
Rat(315121) CDC42 effector protein (Rho GTPase binding) 1
sheep(101122773) CDC42 effector protein (Rho GTPase binding) 1
domestic guinea pig(100721063) CDC42 effector protein (Rho GTPase binding) 1
naked mole-rat(101721585) CDC42 effector protein (Rho GTPase binding) 1
chicken(418040) CDC42 effector protein (Rho GTPase binding) 1
domestic cat(101097658) CDC42 effector protein (Rho GTPase binding) 1
cow(511099) CDC42 effector protein (Rho GTPase binding) 1
dog(481267) CDC42 effector protein (Rho GTPase binding) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007061 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152243 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007061 Rosetta Predictions human pricing
NM_152243 Rosetta Predictions human pricing
NM_001079700 Rosetta Predictions rat pricing
NM_027219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186697 predicted 439
2 SASI_Hs01_00186698 predicted 1468
3 SASI_Hs01_00186699 predicted 1473
4 SASI_Hs01_00186700 predicted 1596
5 SASI_Hs01_00186701 predicted 553
6 SASI_Hs01_00186702 predicted 466
7 SASI_Hs01_00186703 predicted 1468
8 SASI_Hs01_00186704 predicted 1580
9 SASI_Hs01_00186705 predicted 409
10 SASI_Hs01_00186706 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135346 predicted 463
2 SASI_Hs01_00135347 predicted 1516
3 SASI_Hs01_00135348 predicted 1520
4 SASI_Hs02_00365741 predicted 1533
5 SASI_Hs01_00135349 predicted 1634
6 SASI_Hs01_00135350 predicted 582
7 SASI_Hs01_00135351 predicted 490
8 SASI_Hs01_00135353 predicted 1631
9 SASI_Hs01_00135354 predicted 429
10 SASI_Hs01_00135355 predicted 1529
11 SASI_Hs01_00135352 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208029 predicted 650
2 SASI_Rn02_00208030 predicted 1476
3 SASI_Rn02_00208031 predicted 783
4 SASI_Rn02_00208032 predicted 1211
5 SASI_Rn02_00208033 predicted 1304
6 SASI_Rn02_00208034 predicted 1216
7 SASI_Rn02_00208035 predicted 1477
8 SASI_Rn02_00208036 predicted 1510
9 SASI_Rn02_00208037 predicted 1706
10 SASI_Rn02_00208038 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199412 predicted 1747
2 SASI_Mm01_00199413 predicted 1908
3 SASI_Mm02_00331769 predicted 666
4 SASI_Mm01_00199414 predicted 879
5 SASI_Mm01_00199415 predicted 1675
6 SASI_Mm01_00199416 predicted 586
7 SASI_Mm01_00199417 predicted 1746
8 SASI_Mm02_00331770 predicted 1622
9 SASI_Mm01_00199418 predicted 1783
10 SASI_Mm01_00199419 predicted 568
11 SASI_Mm01_00199411 predicted 959
12 SASI_Mm01_00199420 predicted 686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007061
VALIDATED
CDC42EP1 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-1471s1c1
Sequence:CCGGGCAAGCAAACACCTTTGAATTCTCGAGAATTCAAAGGTGTTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-444s1c1
Sequence:CCGGTGTCCAGTTCACAGGGAAAGACTCGAGTCTTTCCCTGTGAACTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-934s1c1
Sequence:CCGGTCGCCGCTCTGACTCTCTCTTCTCGAGAAGAGAGAGTCAGAGCGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007061.3-1483s1c1
Sequence:CCGGCTTTGAATTTGCGGATGCTGACTCGAGTCAGCATCCGCAAATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-714s1c1
Sequence:CCGGCCATCATCAAGAACGCCATCTCTCGAGAGATGGCGTTCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007061
VALIDATED
CDC42EP1 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-1471s1c1
Sequence:CCGGGCAAGCAAACACCTTTGAATTCTCGAGAATTCAAAGGTGTTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-444s1c1
Sequence:CCGGTGTCCAGTTCACAGGGAAAGACTCGAGTCTTTCCCTGTGAACTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-934s1c1
Sequence:CCGGTCGCCGCTCTGACTCTCTCTTCTCGAGAAGAGAGAGTCAGAGCGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007061.3-1483s1c1
Sequence:CCGGCTTTGAATTTGCGGATGCTGACTCGAGTCAGCATCCGCAAATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-714s1c1
Sequence:CCGGCCATCATCAAGAACGCCATCTCTCGAGAGATGGCGTTCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007061
VALIDATED
CDC42EP1 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-1471s1c1
Sequence:CCGGGCAAGCAAACACCTTTGAATTCTCGAGAATTCAAAGGTGTTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-444s1c1
Sequence:CCGGTGTCCAGTTCACAGGGAAAGACTCGAGTCTTTCCCTGTGAACTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-934s1c1
Sequence:CCGGTCGCCGCTCTGACTCTCTCTTCTCGAGAAGAGAGAGTCAGAGCGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007061.3-1483s1c1
Sequence:CCGGCTTTGAATTTGCGGATGCTGACTCGAGTCAGCATCCGCAAATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007061.3-714s1c1
Sequence:CCGGCCATCATCAAGAACGCCATCTCTCGAGAGATGGCGTTCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027219
VALIDATED
CDC42EP1 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027219.1-2205s1c1
Sequence:CCGGGCCTGGAATGTTCAACGATAACTCGAGTTATCGTTGAACATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027219.1-1525s1c1
Sequence:CCGGGCCTTTGAGTTTGCTGATGCTCTCGAGAGCATCAGCAAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027219.1-889s1c1
Sequence:CCGGCATTCTCAAGACCGAGAGCAACTCGAGTTGCTCTCGGTCTTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027219.1-726s1c1
Sequence:CCGGCACCTATGACAGTCTGGTGATCTCGAGATCACCAGACTGTCATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027219.1-1136s1c1
Sequence:CCGGCCACTCTAGATGCTGTGACAACTCGAGTTGTCACAGCATCTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-675s21c1
Sequence:CCGGATCTCGCCCATCATCAAGAACCTCGAGGTTCTTGATGATGGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-1552s21c1
Sequence:CCGGATGACGAGGTCAAGGTGTAAGCTCGAGCTTACACCTTGACCTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-1524s21c1
Sequence:CCGGGCCTTTGAGTTTGCTGATGCTCTCGAGAGCATCAGCAAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027219.3-2204s21c1
Sequence:CCGGGCCTGGAATGTTCAACGATAACTCGAGTTATCGTTGAACATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-1300s21c1
Sequence:CCGGTACCCTCCAACATGGCCTTTGCTCGAGCAAAGGCCATGTTGGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027219
VALIDATED
CDC42EP1 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027219.1-2205s1c1
Sequence:CCGGGCCTGGAATGTTCAACGATAACTCGAGTTATCGTTGAACATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027219.1-1525s1c1
Sequence:CCGGGCCTTTGAGTTTGCTGATGCTCTCGAGAGCATCAGCAAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027219.1-889s1c1
Sequence:CCGGCATTCTCAAGACCGAGAGCAACTCGAGTTGCTCTCGGTCTTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027219.1-726s1c1
Sequence:CCGGCACCTATGACAGTCTGGTGATCTCGAGATCACCAGACTGTCATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027219.1-1136s1c1
Sequence:CCGGCCACTCTAGATGCTGTGACAACTCGAGTTGTCACAGCATCTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-675s21c1
Sequence:CCGGATCTCGCCCATCATCAAGAACCTCGAGGTTCTTGATGATGGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-1552s21c1
Sequence:CCGGATGACGAGGTCAAGGTGTAAGCTCGAGCTTACACCTTGACCTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-1524s21c1
Sequence:CCGGGCCTTTGAGTTTGCTGATGCTCTCGAGAGCATCAGCAAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027219.3-2204s21c1
Sequence:CCGGGCCTGGAATGTTCAACGATAACTCGAGTTATCGTTGAACATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-1300s21c1
Sequence:CCGGTACCCTCCAACATGGCCTTTGCTCGAGCAAAGGCCATGTTGGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027219
VALIDATED
CDC42EP1 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027219.1-2205s1c1
Sequence:CCGGGCCTGGAATGTTCAACGATAACTCGAGTTATCGTTGAACATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027219.1-1525s1c1
Sequence:CCGGGCCTTTGAGTTTGCTGATGCTCTCGAGAGCATCAGCAAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027219.1-889s1c1
Sequence:CCGGCATTCTCAAGACCGAGAGCAACTCGAGTTGCTCTCGGTCTTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027219.1-726s1c1
Sequence:CCGGCACCTATGACAGTCTGGTGATCTCGAGATCACCAGACTGTCATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027219.1-1136s1c1
Sequence:CCGGCCACTCTAGATGCTGTGACAACTCGAGTTGTCACAGCATCTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-675s21c1
Sequence:CCGGATCTCGCCCATCATCAAGAACCTCGAGGTTCTTGATGATGGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-1552s21c1
Sequence:CCGGATGACGAGGTCAAGGTGTAAGCTCGAGCTTACACCTTGACCTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-1524s21c1
Sequence:CCGGGCCTTTGAGTTTGCTGATGCTCTCGAGAGCATCAGCAAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027219.3-2204s21c1
Sequence:CCGGGCCTGGAATGTTCAACGATAACTCGAGTTATCGTTGAACATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027219.3-1300s21c1
Sequence:CCGGTACCCTCCAACATGGCCTTTGCTCGAGCAAAGGCCATGTTGGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152243
CDC42EP1 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000310246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152243.2-498s21c1
Sequence:CCGGGGCTGACTGCAGACATGATCACTCGAGTGATCATGTCTGCAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152243.2-1796s21c1
Sequence:CCGGACTGCCACTCTGGACCTAATACTCGAGTATTAGGTCCAGAGTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152243.2-964s21c1
Sequence:CCGGTCGCCGCTCTGACTCTCTCTTCTCGAGAAGAGAGAGTCAGAGCGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152243.2-744s21c1
Sequence:CCGGCCATCATCAAGAACGCCATCTCTCGAGAGATGGCGTTCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152243
CDC42EP1 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000310246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152243.2-498s21c1
Sequence:CCGGGGCTGACTGCAGACATGATCACTCGAGTGATCATGTCTGCAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152243.2-1796s21c1
Sequence:CCGGACTGCCACTCTGGACCTAATACTCGAGTATTAGGTCCAGAGTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152243.2-964s21c1
Sequence:CCGGTCGCCGCTCTGACTCTCTCTTCTCGAGAAGAGAGAGTCAGAGCGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152243.2-744s21c1
Sequence:CCGGCCATCATCAAGAACGCCATCTCTCGAGAGATGGCGTTCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152243
CDC42EP1 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000310246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152243.2-498s21c1
Sequence:CCGGGGCTGACTGCAGACATGATCACTCGAGTGATCATGTCTGCAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152243.2-1796s21c1
Sequence:CCGGACTGCCACTCTGGACCTAATACTCGAGTATTAGGTCCAGAGTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152243.2-964s21c1
Sequence:CCGGTCGCCGCTCTGACTCTCTCTTCTCGAGAAGAGAGAGTCAGAGCGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152243.2-744s21c1
Sequence:CCGGCCATCATCAAGAACGCCATCTCTCGAGAGATGGCGTTCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks