EMAIL THIS PAGE TO A FRIEND

CDC42EP3

CDC42 effector protein (Rho GTPase binding) 3

89 Gene Product Result for
Synonyms: BORG2 CEP3 UB1
UniProtKB ID: Q9UKI2, B2R8S0, O95353, Q9UQJ0
Gene ID:
Human(10602) Summary: This gene encodes a member of a small family of guanosine triphosphate (GTP) metabolizing proteins that contain a CRIB (Cdc42, Rac interactive binding) domain. Members of this family of proteins act as effectors of CDC42 function. The encoded protein is involved in actin cytoskeleton re-organization during cell shape changes, including pseudopodia formation. A pseudogene of this gene is found on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(260409) CDC42 effector protein (Rho GTPase binding) 3
Rat(313838) CDC42 effector protein (Rho GTPase binding) 3
sheep(101120399) CDC42 effector protein (Rho GTPase binding) 3
domestic guinea pig(100712937) CDC42 effector protein (Rho GTPase binding) 3
Zebrafish(447829) CDC42 effector protein (Rho GTPase binding) 3
cow(538967) CDC42 effector protein (Rho GTPase binding) 3
domestic cat(101100382) CDC42 effector protein (Rho GTPase binding) 3
dog(475726) CDC42 effector protein (Rho GTPase binding) 3
chicken(428577) CDC42 effector protein (Rho GTPase binding) 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU012481 MISSION® esiRNA esiRNA targeting mouse Cdc42ep3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006449 Rosetta Predictions human pricing
NM_001048044 Rosetta Predictions rat pricing
NM_026514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182422 predicted 1340
2 SASI_Hs01_00182424 predicted 1140
3 SASI_Hs01_00182425 predicted 1033
4 SASI_Hs01_00182426 predicted 1340
5 SASI_Hs02_00341588 predicted 1139
6 SASI_Hs01_00182427 predicted 1359
7 SASI_Hs01_00182428 predicted 1103
8 SASI_Hs01_00182429 predicted 1396
9 SASI_Hs01_00182430 predicted 1381
10 SASI_Hs01_00182431 predicted 1619
11 SASI_Hs01_00182423 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207334 predicted 580
2 SASI_Rn02_00207335 predicted 892
3 SASI_Rn02_00207336 predicted 575
4 SASI_Rn02_00207337 predicted 470
5 SASI_Rn02_00207338 predicted 476
6 SASI_Rn02_00207339 predicted 844
7 SASI_Rn02_00207340 predicted 1077
8 SASI_Rn02_00207341 predicted 824
9 SASI_Rn02_00207342 predicted 748
10 SASI_Rn02_00207343 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059270 predicted 693
2 SASI_Mm01_00059271 predicted 1156
3 SASI_Mm01_00059272 predicted 874
4 SASI_Mm01_00059273 predicted 1205
5 SASI_Mm01_00059275 predicted 774
6 SASI_Mm01_00059276 predicted 848
7 SASI_Mm01_00059277 predicted 1130
8 SASI_Mm01_00059278 predicted 898
9 SASI_Mm01_00059279 predicted 1135
10 SASI_Mm02_00330417 predicted 852
11 SASI_Mm01_00059274 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006449
CDC42EP3 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1366s1c1
Sequence:CCGGCCAGTGACATTTAATTCCAAACTCGAGTTTGGAATTAAATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1227s1c1
Sequence:CCGGCCCTGGGCATAATGAGTTCTTCTCGAGAAGAACTCATTATGCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1355s1c1
Sequence:CCGGCCTTATTGTCACCAGTGACATCTCGAGATGTCACTGGTGACAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1141s1c1
Sequence:CCGGCACGATGTCTTTGGAGATATTCTCGAGAATATCTCCAAAGACATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1729s1c1
Sequence:CCGGGTGCTGAATGTAATGGATAAACTCGAGTTTATCCATTACATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006449.3-2097s21c1
Sequence:CCGGGGAACTTCACGGAACTTTATACTCGAGTATAAAGTTCCGTGAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006449.3-2001s21c1
Sequence:CCGGGGTGATGTTCGGCTCACATATCTCGAGATATGTGAGCCGAACATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006449.3-1630s21c1
Sequence:CCGGCTCATCAAGGGAAAGACTAAGCTCGAGCTTAGTCTTTCCCTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006449
CDC42EP3 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1366s1c1
Sequence:CCGGCCAGTGACATTTAATTCCAAACTCGAGTTTGGAATTAAATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1227s1c1
Sequence:CCGGCCCTGGGCATAATGAGTTCTTCTCGAGAAGAACTCATTATGCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1355s1c1
Sequence:CCGGCCTTATTGTCACCAGTGACATCTCGAGATGTCACTGGTGACAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1141s1c1
Sequence:CCGGCACGATGTCTTTGGAGATATTCTCGAGAATATCTCCAAAGACATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1729s1c1
Sequence:CCGGGTGCTGAATGTAATGGATAAACTCGAGTTTATCCATTACATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006449.3-2097s21c1
Sequence:CCGGGGAACTTCACGGAACTTTATACTCGAGTATAAAGTTCCGTGAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006449.3-2001s21c1
Sequence:CCGGGGTGATGTTCGGCTCACATATCTCGAGATATGTGAGCCGAACATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006449.3-1630s21c1
Sequence:CCGGCTCATCAAGGGAAAGACTAAGCTCGAGCTTAGTCTTTCCCTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006449
CDC42EP3 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1366s1c1
Sequence:CCGGCCAGTGACATTTAATTCCAAACTCGAGTTTGGAATTAAATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1227s1c1
Sequence:CCGGCCCTGGGCATAATGAGTTCTTCTCGAGAAGAACTCATTATGCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1355s1c1
Sequence:CCGGCCTTATTGTCACCAGTGACATCTCGAGATGTCACTGGTGACAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1141s1c1
Sequence:CCGGCACGATGTCTTTGGAGATATTCTCGAGAATATCTCCAAAGACATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006449.3-1729s1c1
Sequence:CCGGGTGCTGAATGTAATGGATAAACTCGAGTTTATCCATTACATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006449.3-2097s21c1
Sequence:CCGGGGAACTTCACGGAACTTTATACTCGAGTATAAAGTTCCGTGAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006449.3-2001s21c1
Sequence:CCGGGGTGATGTTCGGCTCACATATCTCGAGATATGTGAGCCGAACATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006449.3-1630s21c1
Sequence:CCGGCTCATCAAGGGAAAGACTAAGCTCGAGCTTAGTCTTTCCCTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026514
CDC42EP3 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 3
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026514.1-1777s1c1
Sequence:CCGGCGAAGTCTCCAGCGTTATGATCTCGAGATCATAACGCTGGAGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-1144s1c1
Sequence:CCGGGTGAAGTCAAAGACTAAATCACTCGAGTGATTTAGTCTTTGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026514.1-776s1c1
Sequence:CCGGCGGACTCAATGTTCACAGAAACTCGAGTTTCTGTGAACATTGAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026514.1-942s1c1
Sequence:CCGGGCCTGTCATGGAAGAGAAAGTCTCGAGACTTTCTCTTCCATGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026514.1-1627s1c1
Sequence:CCGGGCAGAAATCCAGGCTGTCTAACTCGAGTTAGACAGCCTGGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026514.1-531s1c1
Sequence:CCGGGAAAGCGGCTAACAACAAGAACTCGAGTTCTTGTTGTTAGCCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-1133s1c1
Sequence:CCGGCCTGTGAGCTTGTGAAGTCAACTCGAGTTGACTTCACAAGCTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026514.1-1584s1c1
Sequence:CCGGGCATTGCTGATGCTCATACATCTCGAGATGTATGAGCATCAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-952s1c1
Sequence:CCGGGAAGAGAAAGTTCAGGAGCAACTCGAGTTGCTCCTGAACTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-877s1c1
Sequence:CCGGCCAGTGACATTTCATTCCAAACTCGAGTTTGGAATGAAATGTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-558s1c1
Sequence:CCGGGAAATTTAAACTGAGGGACATCTCGAGATGTCCCTCAGTTTAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026514.2-1580s21c1
Sequence:CCGGAGGCATTGCTGATGCTCATACCTCGAGGTATGAGCATCAGCAATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026514.2-963s21c1
Sequence:CCGGAGGAGCAAAGTAGTCTATTAGCTCGAGCTAATAGACTACTTTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026514.2-1554s21c1
Sequence:CCGGGAAGTGAGTCAGAGCTCATTTCTCGAGAAATGAGCTCTGACTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026514.2-1672s21c1
Sequence:CCGGAGGCAATTCATTGCATGTTATCTCGAGATAACATGCAATGAATTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026514
CDC42EP3 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 3
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026514.1-1777s1c1
Sequence:CCGGCGAAGTCTCCAGCGTTATGATCTCGAGATCATAACGCTGGAGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-1144s1c1
Sequence:CCGGGTGAAGTCAAAGACTAAATCACTCGAGTGATTTAGTCTTTGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026514.1-776s1c1
Sequence:CCGGCGGACTCAATGTTCACAGAAACTCGAGTTTCTGTGAACATTGAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026514.1-942s1c1
Sequence:CCGGGCCTGTCATGGAAGAGAAAGTCTCGAGACTTTCTCTTCCATGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026514.1-1627s1c1
Sequence:CCGGGCAGAAATCCAGGCTGTCTAACTCGAGTTAGACAGCCTGGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026514.1-531s1c1
Sequence:CCGGGAAAGCGGCTAACAACAAGAACTCGAGTTCTTGTTGTTAGCCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-1133s1c1
Sequence:CCGGCCTGTGAGCTTGTGAAGTCAACTCGAGTTGACTTCACAAGCTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026514.1-1584s1c1
Sequence:CCGGGCATTGCTGATGCTCATACATCTCGAGATGTATGAGCATCAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-952s1c1
Sequence:CCGGGAAGAGAAAGTTCAGGAGCAACTCGAGTTGCTCCTGAACTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-877s1c1
Sequence:CCGGCCAGTGACATTTCATTCCAAACTCGAGTTTGGAATGAAATGTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-558s1c1
Sequence:CCGGGAAATTTAAACTGAGGGACATCTCGAGATGTCCCTCAGTTTAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026514.2-1580s21c1
Sequence:CCGGAGGCATTGCTGATGCTCATACCTCGAGGTATGAGCATCAGCAATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026514.2-963s21c1
Sequence:CCGGAGGAGCAAAGTAGTCTATTAGCTCGAGCTAATAGACTACTTTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026514.2-1554s21c1
Sequence:CCGGGAAGTGAGTCAGAGCTCATTTCTCGAGAAATGAGCTCTGACTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026514.2-1672s21c1
Sequence:CCGGAGGCAATTCATTGCATGTTATCTCGAGATAACATGCAATGAATTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026514
CDC42EP3 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 3
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026514.1-1777s1c1
Sequence:CCGGCGAAGTCTCCAGCGTTATGATCTCGAGATCATAACGCTGGAGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-1144s1c1
Sequence:CCGGGTGAAGTCAAAGACTAAATCACTCGAGTGATTTAGTCTTTGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026514.1-776s1c1
Sequence:CCGGCGGACTCAATGTTCACAGAAACTCGAGTTTCTGTGAACATTGAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026514.1-942s1c1
Sequence:CCGGGCCTGTCATGGAAGAGAAAGTCTCGAGACTTTCTCTTCCATGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026514.1-1627s1c1
Sequence:CCGGGCAGAAATCCAGGCTGTCTAACTCGAGTTAGACAGCCTGGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026514.1-531s1c1
Sequence:CCGGGAAAGCGGCTAACAACAAGAACTCGAGTTCTTGTTGTTAGCCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-1133s1c1
Sequence:CCGGCCTGTGAGCTTGTGAAGTCAACTCGAGTTGACTTCACAAGCTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026514.1-1584s1c1
Sequence:CCGGGCATTGCTGATGCTCATACATCTCGAGATGTATGAGCATCAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-952s1c1
Sequence:CCGGGAAGAGAAAGTTCAGGAGCAACTCGAGTTGCTCCTGAACTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-877s1c1
Sequence:CCGGCCAGTGACATTTCATTCCAAACTCGAGTTTGGAATGAAATGTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026514.1-558s1c1
Sequence:CCGGGAAATTTAAACTGAGGGACATCTCGAGATGTCCCTCAGTTTAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026514.2-1580s21c1
Sequence:CCGGAGGCATTGCTGATGCTCATACCTCGAGGTATGAGCATCAGCAATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026514.2-963s21c1
Sequence:CCGGAGGAGCAAAGTAGTCTATTAGCTCGAGCTAATAGACTACTTTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026514.2-1554s21c1
Sequence:CCGGGAAGTGAGTCAGAGCTCATTTCTCGAGAAATGAGCTCTGACTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026514.2-1672s21c1
Sequence:CCGGAGGCAATTCATTGCATGTTATCTCGAGATAACATGCAATGAATTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks