EMAIL THIS PAGE TO A FRIEND

CDC42EP4

CDC42 effector protein (Rho GTPase binding) 4

Synonyms: BORG4 CEP4 KAIA1777
UniProtKB ID: Q9H3Q1, O95828, Q96FT3
Gene ID:
Human(23580) Summary: The product of this gene is a member of the CDC42-binding protein family. Members of this family interact with Rho family GTPases and regulate the organization of the actin cytoskeleton. This protein has been shown to bind both CDC42 and TC10 GTPases in a GTP-dependent manner. When overexpressed in fibroblasts, this protein was able to induce pseudopodia formation, which suggested a role in inducing actin filament assembly and cell shape control. [provided by RefSeq, Jul 2008]
Mouse(56699) CDC42 effector protein (Rho GTPase binding) 4
Rat(303653) CDC42 effector protein (Rho GTPase binding) 4
chicken(771509) CDC42 effector protein (Rho GTPase binding) 4
dog(475907) CDC42 effector protein (Rho GTPase binding) 4
cow(540152) CDC42 effector protein (Rho GTPase binding) 4
domestic cat(101092563) CDC42 effector protein (Rho GTPase binding) 4
naked mole-rat(101718514) CDC42 effector protein (Rho GTPase binding) 4
domestic guinea pig(100719393) CDC42 effector protein (Rho GTPase binding) 4
sheep(101107208) CDC42 effector protein (Rho GTPase binding) 4
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012121 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133751 MISSION® esiRNA esiRNA human CDC42EP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012121 Rosetta Predictions human pricing
NM_001107063 Rosetta Predictions rat pricing
NM_020006 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343666 predicted 1045
2 SASI_Hs01_00100332 predicted 372
3 SASI_Hs01_00100333 predicted 361
4 SASI_Hs01_00100334 predicted 1550
5 SASI_Hs01_00100335 predicted 420
6 SASI_Hs01_00100336 predicted 551
7 SASI_Hs02_00343667 predicted 245
8 SASI_Hs01_00100337 predicted 1394
9 SASI_Hs01_00100339 predicted 1274
10 SASI_Hs01_00100340 predicted 1683
11 SASI_Hs01_00100331 predicted 424
12 SASI_Hs01_00100338 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225126 predicted 584
2 SASI_Rn02_00225127 predicted 1189
3 SASI_Rn02_00225128 predicted 511
4 SASI_Rn02_00225129 predicted 886
5 SASI_Rn02_00225130 predicted 623
6 SASI_Rn02_00225131 predicted 345
7 SASI_Rn02_00225132 predicted 1442
8 SASI_Rn02_00225133 predicted 334
9 SASI_Rn02_00225134 predicted 258
10 SASI_Rn02_00225135 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182832 predicted 1715
2 SASI_Mm02_00325372 predicted 2188
3 SASI_Mm01_00182833 predicted 2228
4 SASI_Mm01_00182834 predicted 1005
5 SASI_Mm01_00182835 predicted 1936
6 SASI_Mm02_00325373 predicted 1316
7 SASI_Mm01_00182836 predicted 837
8 SASI_Mm01_00182837 predicted 746
9 SASI_Mm01_00182839 predicted 2146
10 SASI_Mm01_00182840 predicted 1762
11 SASI_Mm01_00182831 predicted 950
12 SASI_Mm01_00182838 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020006
VALIDATED
CDC42EP4 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-1719s21c1
Sequence:CCGGGGAAGATGAGATCCGAGTTTGCTCGAGCAAACTCGGATCTCATCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-1042s21c1
Sequence:CCGGCCTCAGCTCAATGAGAAGGAACTCGAGTTCCTTCTCATTGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020006.1-1811s21c1
Sequence:CCGGGCCACCTTCTCTATGACCTTTCTCGAGAAAGGTCATAGAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-837s21c1
Sequence:CCGGCACGTCTTTCCTCACTAGCAACTCGAGTTGCTAGTGAGGAAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-1010s21c1
Sequence:CCGGCAGCACTGTTTGTCAAGAATGCTCGAGCATTCTTGACAAACAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-1042s1c1
Sequence:CCGGCCTCAGCTCAATGAGAAGGAACTCGAGTTCCTTCTCATTGAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-1043s1c1
Sequence:CCGGCTCAGCTCAATGAGAAGGAAGCTCGAGCTTCCTTCTCATTGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-1811s1c1
Sequence:CCGGGCCACCTTCTCTATGACCTTTCTCGAGAAAGGTCATAGAGAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-837s1c1
Sequence:CCGGCACGTCTTTCCTCACTAGCAACTCGAGTTGCTAGTGAGGAAAGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020006
VALIDATED
CDC42EP4 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-1719s21c1
Sequence:CCGGGGAAGATGAGATCCGAGTTTGCTCGAGCAAACTCGGATCTCATCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-1042s21c1
Sequence:CCGGCCTCAGCTCAATGAGAAGGAACTCGAGTTCCTTCTCATTGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020006.1-1811s21c1
Sequence:CCGGGCCACCTTCTCTATGACCTTTCTCGAGAAAGGTCATAGAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-837s21c1
Sequence:CCGGCACGTCTTTCCTCACTAGCAACTCGAGTTGCTAGTGAGGAAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-1010s21c1
Sequence:CCGGCAGCACTGTTTGTCAAGAATGCTCGAGCATTCTTGACAAACAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-1042s1c1
Sequence:CCGGCCTCAGCTCAATGAGAAGGAACTCGAGTTCCTTCTCATTGAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-1043s1c1
Sequence:CCGGCTCAGCTCAATGAGAAGGAAGCTCGAGCTTCCTTCTCATTGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-1811s1c1
Sequence:CCGGGCCACCTTCTCTATGACCTTTCTCGAGAAAGGTCATAGAGAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-837s1c1
Sequence:CCGGCACGTCTTTCCTCACTAGCAACTCGAGTTGCTAGTGAGGAAAGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020006
VALIDATED
CDC42EP4 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-1719s21c1
Sequence:CCGGGGAAGATGAGATCCGAGTTTGCTCGAGCAAACTCGGATCTCATCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-1042s21c1
Sequence:CCGGCCTCAGCTCAATGAGAAGGAACTCGAGTTCCTTCTCATTGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020006.1-1811s21c1
Sequence:CCGGGCCACCTTCTCTATGACCTTTCTCGAGAAAGGTCATAGAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-837s21c1
Sequence:CCGGCACGTCTTTCCTCACTAGCAACTCGAGTTGCTAGTGAGGAAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020006.1-1010s21c1
Sequence:CCGGCAGCACTGTTTGTCAAGAATGCTCGAGCATTCTTGACAAACAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-1042s1c1
Sequence:CCGGCCTCAGCTCAATGAGAAGGAACTCGAGTTCCTTCTCATTGAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-1043s1c1
Sequence:CCGGCTCAGCTCAATGAGAAGGAAGCTCGAGCTTCCTTCTCATTGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-1811s1c1
Sequence:CCGGGCCACCTTCTCTATGACCTTTCTCGAGAAAGGTCATAGAGAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020006.1-837s1c1
Sequence:CCGGCACGTCTTTCCTCACTAGCAACTCGAGTTGCTAGTGAGGAAAGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012121
VALIDATED
CDC42EP4 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-2540s21c1
Sequence:CCGGTGCTGAGTTAAACGCAAATTTCTCGAGAAATTTGCGTTTAACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-826s21c1
Sequence:CCGGAGCATGCGGAGTCCATCATGTCTCGAGACATGATGGACTCCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-368s21c1
Sequence:CCGGGGACACCTCCTTCCTCAATAGCTCGAGCTATTGAGGAAGGAGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-550s21c1
Sequence:CCGGCGGCCCTGTTTGTCAAGAATGCTCGAGCATTCTTGACAAACAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-417s21c1
Sequence:CCGGTTGGACGAACAGCCCTCTTCTCTCGAGAGAAGAGGGCTGTTCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-553s1c1
Sequence:CCGGCCTGTTTGTCAAGAATGCCATCTCGAGATGGCATTCTTGACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-414s1c1
Sequence:CCGGCCTTGGACGAACAGCCCTCTTCTCGAGAAGAGGGCTGTTCGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-604s1c1
Sequence:CCGGCGCGGAGAAGGGCACCAGTAACTCGAGTTACTGGTGCCCTTCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-1272s1c1
Sequence:CCGGAGGAGGATGAAATCCGTGTGTCTCGAGACACACGGATTTCATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-1240s1c1
Sequence:CCGGAGACAAGGAGTTCTCCTTCATCTCGAGATGAAGGAGAACTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012121
VALIDATED
CDC42EP4 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-2540s21c1
Sequence:CCGGTGCTGAGTTAAACGCAAATTTCTCGAGAAATTTGCGTTTAACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-826s21c1
Sequence:CCGGAGCATGCGGAGTCCATCATGTCTCGAGACATGATGGACTCCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-368s21c1
Sequence:CCGGGGACACCTCCTTCCTCAATAGCTCGAGCTATTGAGGAAGGAGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-550s21c1
Sequence:CCGGCGGCCCTGTTTGTCAAGAATGCTCGAGCATTCTTGACAAACAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-417s21c1
Sequence:CCGGTTGGACGAACAGCCCTCTTCTCTCGAGAGAAGAGGGCTGTTCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-553s1c1
Sequence:CCGGCCTGTTTGTCAAGAATGCCATCTCGAGATGGCATTCTTGACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-414s1c1
Sequence:CCGGCCTTGGACGAACAGCCCTCTTCTCGAGAAGAGGGCTGTTCGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-604s1c1
Sequence:CCGGCGCGGAGAAGGGCACCAGTAACTCGAGTTACTGGTGCCCTTCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-1272s1c1
Sequence:CCGGAGGAGGATGAAATCCGTGTGTCTCGAGACACACGGATTTCATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-1240s1c1
Sequence:CCGGAGACAAGGAGTTCTCCTTCATCTCGAGATGAAGGAGAACTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012121
VALIDATED
CDC42EP4 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-2540s21c1
Sequence:CCGGTGCTGAGTTAAACGCAAATTTCTCGAGAAATTTGCGTTTAACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-826s21c1
Sequence:CCGGAGCATGCGGAGTCCATCATGTCTCGAGACATGATGGACTCCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-368s21c1
Sequence:CCGGGGACACCTCCTTCCTCAATAGCTCGAGCTATTGAGGAAGGAGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-550s21c1
Sequence:CCGGCGGCCCTGTTTGTCAAGAATGCTCGAGCATTCTTGACAAACAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012121.4-417s21c1
Sequence:CCGGTTGGACGAACAGCCCTCTTCTCTCGAGAGAAGAGGGCTGTTCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-553s1c1
Sequence:CCGGCCTGTTTGTCAAGAATGCCATCTCGAGATGGCATTCTTGACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-414s1c1
Sequence:CCGGCCTTGGACGAACAGCCCTCTTCTCGAGAAGAGGGCTGTTCGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-604s1c1
Sequence:CCGGCGCGGAGAAGGGCACCAGTAACTCGAGTTACTGGTGCCCTTCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-1272s1c1
Sequence:CCGGAGGAGGATGAAATCCGTGTGTCTCGAGACACACGGATTTCATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012121.3-1240s1c1
Sequence:CCGGAGACAAGGAGTTCTCCTTCATCTCGAGATGAAGGAGAACTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks