EMAIL THIS PAGE TO A FRIEND

CDC42EP5

CDC42 effector protein (Rho GTPase binding) 5

43 Gene Product Result for
Synonyms: Borg3 CEP5
UniProtKB ID: Q6NZY7, B0VJZ2, Q8TB51
Gene ID:
Human(148170) Summary: CDC42, a small Rho GTPase, regulates the formation of F-actin-containing structures through its interaction with the downstream effector proteins. The protein encoded by this gene is a member of the Borg family of CDC42 effector proteins. Borg family proteins contain a CRIB (Cdc42/Rac interactive-binding) domain. They bind to, and negatively regulate the function of, CDC42. The specific function of this protein has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(58804) CDC42 effector protein (Rho GTPase binding) 5
Rat(361505) CDC42 effector protein (Rho GTPase binding) 5
dog(611420) CDC42 effector protein (Rho GTPase binding) 5
cow(618745) CDC42 effector protein (Rho GTPase binding) 5
sheep(101106030) CDC42 effector protein (Rho GTPase binding) 5
naked mole-rat(101717171) CDC42 effector protein (Rho GTPase binding) 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145057 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU020451 MISSION® esiRNA esiRNA targeting mouse Cdc42ep5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145057 Rosetta Predictions human pricing
NM_001108469 Rosetta Predictions rat pricing
NM_021454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148032 predicted 784
2 SASI_Hs01_00148033 predicted 785
3 SASI_Hs01_00148034 predicted 606
4 SASI_Hs01_00148035 predicted 648
5 SASI_Hs01_00148036 predicted 781
6 SASI_Hs01_00148037 predicted 432
7 SASI_Hs01_00148038 predicted 396
8 SASI_Hs01_00148039 predicted 791
9 SASI_Hs01_00148040 predicted 422
10 SASI_Hs02_00364954 predicted 427
11 SASI_Hs01_00148041 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238949 predicted 232
2 SASI_Rn02_00238950 predicted 235
3 SASI_Rn02_00238951 predicted 227
4 SASI_Rn02_00238952 predicted 209
5 SASI_Rn02_00238953 predicted 243
6 SASI_Rn02_00238954 predicted 245
7 SASI_Rn02_00238955 predicted 257
8 SASI_Rn02_00238956 predicted 246
9 SASI_Rn02_00238957 predicted 211
10 SASI_Rn02_00238958 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141839 predicted 417
2 SASI_Mm01_00141840 predicted 598
3 SASI_Mm01_00141841 predicted 393
4 SASI_Mm01_00141842 predicted 380
5 SASI_Mm01_00141843 predicted 414
6 SASI_Mm01_00141844 predicted 643
7 SASI_Mm01_00141845 predicted 376
8 SASI_Mm01_00141846 predicted 591
9 SASI_Mm01_00141847 predicted 380
10 SASI_Mm01_00141848 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145057
CDC42EP5 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-440s1c1
Sequence:CCGGCTTCCGGCACACGCTGCACGTCTCGAGACGTGCAGCGTGTGCCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-488s1c1
Sequence:CCGGCACCTCGTTCCTGAGCCGCCACTCGAGTGGCGGCTCAGGAACGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-384s1c1
Sequence:CCGGCAGCCCAAGAAGCGGCCTGATCTCGAGATCAGGCCGCTTCTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-615s1c1
Sequence:CCGGCTGCTGTCCTTCCACCTGGATCTCGAGATCCAGGTGGAAGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145057.2-772s21c1
Sequence:CCGGTCGAGCTGAACGACGTCATCGCTCGAGCGATGACGTCGTTCAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145057.2-616s21c1
Sequence:CCGGTGCTGTCCTTCCACCTGGATCCTCGAGGATCCAGGTGGAAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145057.2-385s21c1
Sequence:CCGGAGCCCAAGAAGCGGCCTGATCCTCGAGGATCAGGCCGCTTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145057
CDC42EP5 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-440s1c1
Sequence:CCGGCTTCCGGCACACGCTGCACGTCTCGAGACGTGCAGCGTGTGCCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-488s1c1
Sequence:CCGGCACCTCGTTCCTGAGCCGCCACTCGAGTGGCGGCTCAGGAACGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-384s1c1
Sequence:CCGGCAGCCCAAGAAGCGGCCTGATCTCGAGATCAGGCCGCTTCTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-615s1c1
Sequence:CCGGCTGCTGTCCTTCCACCTGGATCTCGAGATCCAGGTGGAAGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145057.2-772s21c1
Sequence:CCGGTCGAGCTGAACGACGTCATCGCTCGAGCGATGACGTCGTTCAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145057.2-616s21c1
Sequence:CCGGTGCTGTCCTTCCACCTGGATCCTCGAGGATCCAGGTGGAAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145057.2-385s21c1
Sequence:CCGGAGCCCAAGAAGCGGCCTGATCCTCGAGGATCAGGCCGCTTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145057
CDC42EP5 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-440s1c1
Sequence:CCGGCTTCCGGCACACGCTGCACGTCTCGAGACGTGCAGCGTGTGCCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-488s1c1
Sequence:CCGGCACCTCGTTCCTGAGCCGCCACTCGAGTGGCGGCTCAGGAACGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-384s1c1
Sequence:CCGGCAGCCCAAGAAGCGGCCTGATCTCGAGATCAGGCCGCTTCTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145057.2-615s1c1
Sequence:CCGGCTGCTGTCCTTCCACCTGGATCTCGAGATCCAGGTGGAAGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145057.2-772s21c1
Sequence:CCGGTCGAGCTGAACGACGTCATCGCTCGAGCGATGACGTCGTTCAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145057.2-616s21c1
Sequence:CCGGTGCTGTCCTTCCACCTGGATCCTCGAGGATCCAGGTGGAAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145057.2-385s21c1
Sequence:CCGGAGCCCAAGAAGCGGCCTGATCCTCGAGGATCAGGCCGCTTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021454
VALIDATED
CDC42EP5 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-427s21c1
Sequence:CCGGTTCAGGCACACATTGCACGTGCTCGAGCACGTGCAATGTGTGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021454.3-370s21c1
Sequence:CCGGCAACCCAAGAAGCGGCTGGATCTCGAGATCCAGCCGCTTCTTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-419s21c1
Sequence:CCGGTCGGAGACTTCAGGCACACATCTCGAGATGTGTGCCTGAAGTCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-389s21c1
Sequence:CCGGATCGCGGAGCACTCTCGATCTCTCGAGAGATCGAGAGTGCTCCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-638s21c1
Sequence:CCGGCTATGCTGGACGCGGTGTTAGCTCGAGCTAACACCGCGTCCAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021454
VALIDATED
CDC42EP5 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-427s21c1
Sequence:CCGGTTCAGGCACACATTGCACGTGCTCGAGCACGTGCAATGTGTGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021454.3-370s21c1
Sequence:CCGGCAACCCAAGAAGCGGCTGGATCTCGAGATCCAGCCGCTTCTTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-419s21c1
Sequence:CCGGTCGGAGACTTCAGGCACACATCTCGAGATGTGTGCCTGAAGTCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-389s21c1
Sequence:CCGGATCGCGGAGCACTCTCGATCTCTCGAGAGATCGAGAGTGCTCCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-638s21c1
Sequence:CCGGCTATGCTGGACGCGGTGTTAGCTCGAGCTAACACCGCGTCCAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021454
VALIDATED
CDC42EP5 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-427s21c1
Sequence:CCGGTTCAGGCACACATTGCACGTGCTCGAGCACGTGCAATGTGTGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021454.3-370s21c1
Sequence:CCGGCAACCCAAGAAGCGGCTGGATCTCGAGATCCAGCCGCTTCTTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-419s21c1
Sequence:CCGGTCGGAGACTTCAGGCACACATCTCGAGATGTGTGCCTGAAGTCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-389s21c1
Sequence:CCGGATCGCGGAGCACTCTCGATCTCTCGAGAGATCGAGAGTGCTCCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021454.3-638s21c1
Sequence:CCGGCTATGCTGGACGCGGTGTTAGCTCGAGCTAACACCGCGTCCAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks