EMAIL THIS PAGE TO A FRIEND

CDC42SE1

CDC42 small effector 1

165 Gene Product Result for
Synonyms: SCIP1 SPEC1
UniProtKB ID: Q9NRR8, D3DV12, Q9HB17, Q9NQR2
Gene ID:
Mouse(57912) CDC42 small effector 1
Rat(499672) CDC42 small effector 1
Zebrafish(791998) CDC42 small effector 1
cow(614042) CDC42 small effector 1
domestic cat(101095840) CDC42 small effector 1
dog(608900) CDC42 small effector 1
chicken(100857323) CDC42 small effector 1
naked mole-rat(101710236) CDC42 small effector 1
domestic guinea pig(100728193) CDC42 small effector 1
sheep(101110804) CDC42 small effector 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020239 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038707 Rosetta Predictions human pricing
NM_020239 Rosetta Predictions human pricing
NM_001039044 Rosetta Predictions rat pricing
NM_001038708 Rosetta Predictions mouse pricing
NM_172395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115305 predicted 1077
2 SASI_Hs01_00115306 predicted 1191
3 SASI_Hs01_00115307 predicted 769
4 SASI_Hs01_00115308 predicted 1109
5 SASI_Hs01_00115309 predicted 888
6 SASI_Hs01_00115310 predicted 747
7 SASI_Hs01_00115311 predicted 766
8 SASI_Hs01_00115312 predicted 883
9 SASI_Hs01_00115313 predicted 1068
10 SASI_Hs01_00115314 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149314 predicted 940
2 SASI_Hs01_00149315 predicted 1062
3 SASI_Hs01_00149316 predicted 637
4 SASI_Hs01_00149317 predicted 978
5 SASI_Hs01_00149318 predicted 749
6 SASI_Hs01_00149319 predicted 609
7 SASI_Hs01_00149320 predicted 631
8 SASI_Hs01_00149321 predicted 755
9 SASI_Hs01_00149322 predicted 928
10 SASI_Hs01_00149323 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096089 predicted 480
2 SASI_Rn01_00096090 predicted 499
3 SASI_Rn01_00096091 predicted 905
4 SASI_Rn01_00096092 predicted 339
5 SASI_Rn01_00096093 predicted 998
6 SASI_Rn01_00096094 predicted 584
7 SASI_Rn01_00096095 predicted 984
8 SASI_Rn01_00096097 predicted 368
9 SASI_Rn02_00204792 predicted 703
10 SASI_Rn02_00204793 predicted 536
11 SASI_Rn01_00096096 predicted 853
12 SASI_Rn01_00096098 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100324 predicted 536
2 SASI_Mm01_00100325 predicted 634
3 SASI_Mm01_00100327 predicted 384
4 SASI_Mm01_00100329 predicted 634
5 SASI_Mm01_00100330 predicted 495
6 SASI_Mm01_00100331 predicted 511
7 SASI_Mm01_00100333 predicted 561
8 SASI_Mm02_00289695 predicted 573
9 SASI_Mm02_00289696 predicted 525
10 SASI_Mm02_00289697 predicted 381
11 SASI_Mm01_00100326 predicted 580
12 SASI_Mm01_00100328 predicted 556
13 SASI_Mm01_00100332 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156653 predicted 556
2 SASI_Mm01_00156654 predicted 648
3 SASI_Mm01_00156656 predicted 405
4 SASI_Mm01_00156658 predicted 661
5 SASI_Mm01_00156659 predicted 520
6 SASI_Mm01_00156660 predicted 529
7 SASI_Mm01_00156662 predicted 586
8 SASI_Mm02_00343843 predicted 603
9 SASI_Mm02_00343844 predicted 542
10 SASI_Mm02_00343845 predicted 404
11 SASI_Mm01_00156655 predicted 604
12 SASI_Mm01_00156657 predicted 582
13 SASI_Mm01_00156661 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172395
VALIDATED
CDC42SE1 MISSION shRNA Bacterial Glycerol Stock
CDC42 small effector 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172395.2-561s21c1
Sequence:CCGGGGAGCAATTCTAGGGCCTTGTCTCGAGACAAGGCCCTAGAATTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172395.2-549s21c1
Sequence:CCGGGTGACAGACCGTGGAGCAATTCTCGAGAATTGCTCCACGGTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172395.2-1080s21c1
Sequence:CCGGCGCTCGGAATTTCAGACCTTACTCGAGTAAGGTCTGAAATTCCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172395.2-526s21c1
Sequence:CCGGGATGAGATCCAAGGGAAACCACTCGAGTGGTTTCCCTTGGATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172395.2-497s21c1
Sequence:CCGGCTTGCCATGACAGGTGCAGTTCTCGAGAACTGCACCTGTCATGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172395.1-524s1c1
Sequence:CCGGGCAGATGAGATCCAAGGGAAACTCGAGTTTCCCTTGGATCTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172395.1-1165s1c1
Sequence:CCGGCCCATGCTTCTGTAGTATTAACTCGAGTTAATACTACAGAAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172395.1-411s1c1
Sequence:CCGGCGGATTGACCGCACTATGATTCTCGAGAATCATAGTGCGGTCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172395.1-1081s1c1
Sequence:CCGGCGCTCGGAATTTCAGACCTTACTCGAGTAAGGTCTGAAATTCCGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172395.1-527s1c1
Sequence:CCGGGATGAGATCCAAGGGAAACCACTCGAGTGGTTTCCCTTGGATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172395.1-446s1c1
Sequence:CCGGCTTTGTCCACCTGACTCACATCTCGAGATGTGAGTCAGGTGGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172395
VALIDATED
CDC42SE1 MISSION shRNA shRNA Plasmid DNA
CDC42 small effector 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172395.2-561s21c1
Sequence:CCGGGGAGCAATTCTAGGGCCTTGTCTCGAGACAAGGCCCTAGAATTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172395.2-549s21c1
Sequence:CCGGGTGACAGACCGTGGAGCAATTCTCGAGAATTGCTCCACGGTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172395.2-1080s21c1
Sequence:CCGGCGCTCGGAATTTCAGACCTTACTCGAGTAAGGTCTGAAATTCCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172395.2-526s21c1
Sequence:CCGGGATGAGATCCAAGGGAAACCACTCGAGTGGTTTCCCTTGGATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172395.2-497s21c1
Sequence:CCGGCTTGCCATGACAGGTGCAGTTCTCGAGAACTGCACCTGTCATGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172395.1-524s1c1
Sequence:CCGGGCAGATGAGATCCAAGGGAAACTCGAGTTTCCCTTGGATCTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172395.1-1165s1c1
Sequence:CCGGCCCATGCTTCTGTAGTATTAACTCGAGTTAATACTACAGAAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172395.1-411s1c1
Sequence:CCGGCGGATTGACCGCACTATGATTCTCGAGAATCATAGTGCGGTCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172395.1-1081s1c1
Sequence:CCGGCGCTCGGAATTTCAGACCTTACTCGAGTAAGGTCTGAAATTCCGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172395.1-527s1c1
Sequence:CCGGGATGAGATCCAAGGGAAACCACTCGAGTGGTTTCCCTTGGATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172395.1-446s1c1
Sequence:CCGGCTTTGTCCACCTGACTCACATCTCGAGATGTGAGTCAGGTGGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172395
VALIDATED
CDC42SE1 MISSION shRNA Lentiviral Transduction Particles
CDC42 small effector 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172395.2-561s21c1
Sequence:CCGGGGAGCAATTCTAGGGCCTTGTCTCGAGACAAGGCCCTAGAATTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172395.2-549s21c1
Sequence:CCGGGTGACAGACCGTGGAGCAATTCTCGAGAATTGCTCCACGGTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172395.2-1080s21c1
Sequence:CCGGCGCTCGGAATTTCAGACCTTACTCGAGTAAGGTCTGAAATTCCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172395.2-526s21c1
Sequence:CCGGGATGAGATCCAAGGGAAACCACTCGAGTGGTTTCCCTTGGATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172395.2-497s21c1
Sequence:CCGGCTTGCCATGACAGGTGCAGTTCTCGAGAACTGCACCTGTCATGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172395.1-524s1c1
Sequence:CCGGGCAGATGAGATCCAAGGGAAACTCGAGTTTCCCTTGGATCTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172395.1-1165s1c1
Sequence:CCGGCCCATGCTTCTGTAGTATTAACTCGAGTTAATACTACAGAAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172395.1-411s1c1
Sequence:CCGGCGGATTGACCGCACTATGATTCTCGAGAATCATAGTGCGGTCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172395.1-1081s1c1
Sequence:CCGGCGCTCGGAATTTCAGACCTTACTCGAGTAAGGTCTGAAATTCCGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172395.1-527s1c1
Sequence:CCGGGATGAGATCCAAGGGAAACCACTCGAGTGGTTTCCCTTGGATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172395.1-446s1c1
Sequence:CCGGCTTTGTCCACCTGACTCACATCTCGAGATGTGAGTCAGGTGGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020239
VALIDATED
CDC42SE1 MISSION shRNA Bacterial Glycerol Stock
CDC42 small effector 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020239.3-665s21c1
Sequence:CCGGGGGCTTATAGCTCCAATAATGCTCGAGCATTATTGGAGCTATAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-1032s21c1
Sequence:CCGGTAAACCTGGAACTCCTTAAATCTCGAGATTTAAGGAGTTCCAGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-640s21c1
Sequence:CCGGGAGATAGGCCATGGAGCAATTCTCGAGAATTGCTCCATGGCCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-617s21c1
Sequence:CCGGGCAGATGAGATCCAAGGGAAACTCGAGTTTCCCTTGGATCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-541s21c1
Sequence:CCGGTTGTTCACCTGACTCACATTGCTCGAGCAATGTGAGTCAGGTGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020239.2-429s1c1
Sequence:CCGGCGGATTGACCGGACCATGATTCTCGAGAATCATGGTCCGGTCAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020239.2-2526s1c1
Sequence:CCGGCCACCCATTCAGTTTGCTTATCTCGAGATAAGCAAACTGAATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020239.2-516s1c1
Sequence:CCGGCTTGCCATGACAGGTGCAGTTCTCGAGAACTGCACCTGTCATGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020239.2-542s1c1
Sequence:CCGGGCAGATGAGATCCAAGGGAAACTCGAGTTTCCCTTGGATCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020239.2-413s1c1
Sequence:CCGGGAAGAAGAAGAGAAGACGGATCTCGAGATCCGTCTTCTCTTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020239
VALIDATED
CDC42SE1 MISSION shRNA shRNA Plasmid DNA
CDC42 small effector 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020239.3-665s21c1
Sequence:CCGGGGGCTTATAGCTCCAATAATGCTCGAGCATTATTGGAGCTATAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-1032s21c1
Sequence:CCGGTAAACCTGGAACTCCTTAAATCTCGAGATTTAAGGAGTTCCAGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-640s21c1
Sequence:CCGGGAGATAGGCCATGGAGCAATTCTCGAGAATTGCTCCATGGCCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-617s21c1
Sequence:CCGGGCAGATGAGATCCAAGGGAAACTCGAGTTTCCCTTGGATCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-541s21c1
Sequence:CCGGTTGTTCACCTGACTCACATTGCTCGAGCAATGTGAGTCAGGTGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020239.2-429s1c1
Sequence:CCGGCGGATTGACCGGACCATGATTCTCGAGAATCATGGTCCGGTCAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020239.2-2526s1c1
Sequence:CCGGCCACCCATTCAGTTTGCTTATCTCGAGATAAGCAAACTGAATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020239.2-516s1c1
Sequence:CCGGCTTGCCATGACAGGTGCAGTTCTCGAGAACTGCACCTGTCATGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020239.2-542s1c1
Sequence:CCGGGCAGATGAGATCCAAGGGAAACTCGAGTTTCCCTTGGATCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020239.2-413s1c1
Sequence:CCGGGAAGAAGAAGAGAAGACGGATCTCGAGATCCGTCTTCTCTTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020239
VALIDATED
CDC42SE1 MISSION shRNA Lentiviral Transduction Particles
CDC42 small effector 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020239.3-665s21c1
Sequence:CCGGGGGCTTATAGCTCCAATAATGCTCGAGCATTATTGGAGCTATAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-1032s21c1
Sequence:CCGGTAAACCTGGAACTCCTTAAATCTCGAGATTTAAGGAGTTCCAGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-640s21c1
Sequence:CCGGGAGATAGGCCATGGAGCAATTCTCGAGAATTGCTCCATGGCCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-617s21c1
Sequence:CCGGGCAGATGAGATCCAAGGGAAACTCGAGTTTCCCTTGGATCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020239.3-541s21c1
Sequence:CCGGTTGTTCACCTGACTCACATTGCTCGAGCAATGTGAGTCAGGTGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020239.2-429s1c1
Sequence:CCGGCGGATTGACCGGACCATGATTCTCGAGAATCATGGTCCGGTCAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020239.2-2526s1c1
Sequence:CCGGCCACCCATTCAGTTTGCTTATCTCGAGATAAGCAAACTGAATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020239.2-516s1c1
Sequence:CCGGCTTGCCATGACAGGTGCAGTTCTCGAGAACTGCACCTGTCATGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020239.2-542s1c1
Sequence:CCGGGCAGATGAGATCCAAGGGAAACTCGAGTTTCCCTTGGATCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020239.2-413s1c1
Sequence:CCGGGAAGAAGAAGAGAAGACGGATCTCGAGATCCGTCTTCTCTTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks