EMAIL THIS PAGE TO A FRIEND

CDC42SE2

CDC42 small effector 2

211 Gene Product Result for
Synonyms: SPEC2
UniProtKB ID: Q9NRR3, B2R622, Q4KMT9
Gene ID:
Mouse(72729) CDC42 small effector 2
Rat(691031) CDC42 small effector 2
sheep(101103563) CDC42 small effector 2
domestic guinea pig(100717248) CDC42 small effector 2
naked mole-rat(101699031) CDC42 small effector 2
chicken(768825) CDC42 small effector 2
dog(609492) CDC42 small effector 2
cow(789618) CDC42 small effector 2
domestic cat(101092823) CDC42 small effector 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020240 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038702 Rosetta Predictions human pricing
NM_020240 Rosetta Predictions human pricing
XM_001076592 Rosetta Predictions rat pricing
NM_178626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223883 predicted 543
2 SASI_Hs01_00223884 predicted 649
3 SASI_Hs01_00223885 predicted 503
4 SASI_Hs01_00223886 predicted 566
5 SASI_Hs01_00223887 predicted 597
6 SASI_Hs01_00223888 predicted 686
7 SASI_Hs01_00223889 predicted 686
8 SASI_Hs01_00223890 predicted 663
9 SASI_Hs01_00223891 predicted 573
10 SASI_Hs01_00223892 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233004 predicted 718
2 SASI_Hs01_00233005 predicted 823
3 SASI_Hs01_00233006 predicted 676
4 SASI_Hs01_00233007 predicted 740
5 SASI_Hs01_00233008 predicted 764
6 SASI_Hs01_00233009 predicted 857
7 SASI_Hs01_00233010 predicted 853
8 SASI_Hs01_00233011 predicted 826
9 SASI_Hs01_00233012 predicted 738
10 SASI_Hs01_00233013 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353823 predicted 380
2 SASI_Rn02_00353824 predicted 427
3 SASI_Rn02_00353825 predicted 293
4 SASI_Rn02_00353826 predicted 452
5 SASI_Rn02_00353827 predicted 374
6 SASI_Rn02_00353828 predicted 347
7 SASI_Rn02_00353829 predicted 275
8 SASI_Rn02_00353830 predicted 279
9 SASI_Rn02_00353831 predicted 262
10 SASI_Rn02_00353832 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083085 predicted 554
2 SASI_Mm01_00083086 predicted 959
3 SASI_Mm01_00083087 predicted 553
4 SASI_Mm01_00083088 predicted 1109
5 SASI_Mm01_00083089 predicted 575
6 SASI_Mm01_00083090 predicted 960
7 SASI_Mm01_00083091 predicted 494
8 SASI_Mm01_00083092 predicted 1044
9 SASI_Mm01_00083093 predicted 969
10 SASI_Mm01_00083094 predicted 958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178626
VALIDATED
CDC42SE2 MISSION shRNA Bacterial Glycerol Stock
CDC42 small effector 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178626.1-621s1c1
Sequence:CCGGCGGAGACCTATTTAGTGGGATCTCGAGATCCCACTAAATAGGTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178626.1-651s1c1
Sequence:CCGGCAGCTCCATTCAGAACCAGATCTCGAGATCTGGTTCTGAATGGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178626.1-656s1c1
Sequence:CCGGCCATTCAGAACCAGATGCAGTCTCGAGACTGCATCTGGTTCTGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178626.1-569s1c1
Sequence:CCGGGAAGTATGATCGGAGAGCCAACTCGAGTTGGCTCTCCGATCATACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178626.1-586s1c1
Sequence:CCGGCCAACCAACTTTGTGCACACACTCGAGTGTGTGCACAAAGTTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178626.1-1413s1c1
Sequence:CCGGGCTGTAAATGTTCAGTGTATTCTCGAGAATACACTGAACATTTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-651s21c1
Sequence:CCGGCCAACCAACTTTGTGCACACACTCGAGTGTGTGCACAAAGTTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-679s21c1
Sequence:CCGGTAGGATCCGGAGACCTATTTACTCGAGTAAATAGGTCTCCGGATCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178626.2-1112s1c1
Sequence:CCGGCTTATGATTTAACTGGTAAACCTCGAGGTTTACCAGTTAAATCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216572    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178626.2-2027s1c1
Sequence:CCGGGAAAGCATTTCTCCTATATTTCTCGAGAAATATAGGAGAAATGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-716s21c1
Sequence:CCGGCAGCTCCATTCAGAACCAGATCTCGAGATCTGGTTCTGAATGGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-621s21c1
Sequence:CCGGCGACGGATTGACCGAAGTATGCTCGAGCATACTTCGGTCAATCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178626.3-1478s21c1
Sequence:CCGGGCTGTAAATGTTCAGTGTATTCTCGAGAATACACTGAACATTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178626
VALIDATED
CDC42SE2 MISSION shRNA shRNA Plasmid DNA
CDC42 small effector 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178626.1-621s1c1
Sequence:CCGGCGGAGACCTATTTAGTGGGATCTCGAGATCCCACTAAATAGGTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178626.1-651s1c1
Sequence:CCGGCAGCTCCATTCAGAACCAGATCTCGAGATCTGGTTCTGAATGGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178626.1-656s1c1
Sequence:CCGGCCATTCAGAACCAGATGCAGTCTCGAGACTGCATCTGGTTCTGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178626.1-569s1c1
Sequence:CCGGGAAGTATGATCGGAGAGCCAACTCGAGTTGGCTCTCCGATCATACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178626.1-586s1c1
Sequence:CCGGCCAACCAACTTTGTGCACACACTCGAGTGTGTGCACAAAGTTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178626.1-1413s1c1
Sequence:CCGGGCTGTAAATGTTCAGTGTATTCTCGAGAATACACTGAACATTTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-651s21c1
Sequence:CCGGCCAACCAACTTTGTGCACACACTCGAGTGTGTGCACAAAGTTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-679s21c1
Sequence:CCGGTAGGATCCGGAGACCTATTTACTCGAGTAAATAGGTCTCCGGATCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178626.2-1112s1c1
Sequence:CCGGCTTATGATTTAACTGGTAAACCTCGAGGTTTACCAGTTAAATCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216572    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178626.2-2027s1c1
Sequence:CCGGGAAAGCATTTCTCCTATATTTCTCGAGAAATATAGGAGAAATGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-716s21c1
Sequence:CCGGCAGCTCCATTCAGAACCAGATCTCGAGATCTGGTTCTGAATGGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-621s21c1
Sequence:CCGGCGACGGATTGACCGAAGTATGCTCGAGCATACTTCGGTCAATCCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178626.3-1478s21c1
Sequence:CCGGGCTGTAAATGTTCAGTGTATTCTCGAGAATACACTGAACATTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178626
VALIDATED
CDC42SE2 MISSION shRNA Lentiviral Transduction Particles
CDC42 small effector 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178626.1-621s1c1
Sequence:CCGGCGGAGACCTATTTAGTGGGATCTCGAGATCCCACTAAATAGGTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178626.1-651s1c1
Sequence:CCGGCAGCTCCATTCAGAACCAGATCTCGAGATCTGGTTCTGAATGGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178626.1-656s1c1
Sequence:CCGGCCATTCAGAACCAGATGCAGTCTCGAGACTGCATCTGGTTCTGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178626.1-569s1c1
Sequence:CCGGGAAGTATGATCGGAGAGCCAACTCGAGTTGGCTCTCCGATCATACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178626.1-586s1c1
Sequence:CCGGCCAACCAACTTTGTGCACACACTCGAGTGTGTGCACAAAGTTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178626.1-1413s1c1
Sequence:CCGGGCTGTAAATGTTCAGTGTATTCTCGAGAATACACTGAACATTTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-651s21c1
Sequence:CCGGCCAACCAACTTTGTGCACACACTCGAGTGTGTGCACAAAGTTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-679s21c1
Sequence:CCGGTAGGATCCGGAGACCTATTTACTCGAGTAAATAGGTCTCCGGATCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178626.2-1112s1c1
Sequence:CCGGCTTATGATTTAACTGGTAAACCTCGAGGTTTACCAGTTAAATCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216572    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178626.2-2027s1c1
Sequence:CCGGGAAAGCATTTCTCCTATATTTCTCGAGAAATATAGGAGAAATGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-716s21c1
Sequence:CCGGCAGCTCCATTCAGAACCAGATCTCGAGATCTGGTTCTGAATGGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178626.3-621s21c1
Sequence:CCGGCGACGGATTGACCGAAGTATGCTCGAGCATACTTCGGTCAATCCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178626.3-1478s21c1
Sequence:CCGGGCTGTAAATGTTCAGTGTATTCTCGAGAATACACTGAACATTTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020240
CDC42SE2 MISSION shRNA Bacterial Glycerol Stock
CDC42 small effector 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-80s1c1
Sequence:CCGGGTATGATTGGAGAGCCCACAACTCGAGTTGTGGGCTCTCCAATCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-62s1c1
Sequence:CCGGGACGGCGGATTGACAGAAGTACTCGAGTACTTCTGTCAATCCGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-28s1c1
Sequence:CCGGTGCTGTATTGCAGAACAGCCTCTCGAGAGGCTGTTCTGCAATACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-66s1c1
Sequence:CCGGGCGGATTGACAGAAGTATGATCTCGAGATCATACTTCTGTCAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-91s1c1
Sequence:CCGGGAGCCCACAAACTTTGTGCATCTCGAGATGCACAAAGTTTGTGGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020240.2-771s21c1
Sequence:CCGGTAGCTCCATTCAGAACCAAATCTCGAGATTTGGTTCTGAATGGAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020240.2-903s21c1
Sequence:CCGGTCCACCCTGTCGTGATTATTCCTCGAGGAATAATCACGACAGGGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020240.2-794s21c1
Sequence:CCGGAGTCCAAGGGAGGTTATGGAGCTCGAGCTCCATAACCTCCCTTGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020240.2-960s21c1
Sequence:CCGGTGTCAGACGAATCCTGCATTTCTCGAGAAATGCAGGATTCGTCTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020240.2-742s21c1
Sequence:CCGGGGAGACCTGTTCAGTGGAATGCTCGAGCATTCCACTGAACAGGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020240
CDC42SE2 MISSION shRNA shRNA Plasmid DNA
CDC42 small effector 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-80s1c1
Sequence:CCGGGTATGATTGGAGAGCCCACAACTCGAGTTGTGGGCTCTCCAATCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-62s1c1
Sequence:CCGGGACGGCGGATTGACAGAAGTACTCGAGTACTTCTGTCAATCCGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-28s1c1
Sequence:CCGGTGCTGTATTGCAGAACAGCCTCTCGAGAGGCTGTTCTGCAATACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-66s1c1
Sequence:CCGGGCGGATTGACAGAAGTATGATCTCGAGATCATACTTCTGTCAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-91s1c1
Sequence:CCGGGAGCCCACAAACTTTGTGCATCTCGAGATGCACAAAGTTTGTGGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020240.2-771s21c1
Sequence:CCGGTAGCTCCATTCAGAACCAAATCTCGAGATTTGGTTCTGAATGGAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020240.2-903s21c1
Sequence:CCGGTCCACCCTGTCGTGATTATTCCTCGAGGAATAATCACGACAGGGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020240.2-794s21c1
Sequence:CCGGAGTCCAAGGGAGGTTATGGAGCTCGAGCTCCATAACCTCCCTTGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020240.2-960s21c1
Sequence:CCGGTGTCAGACGAATCCTGCATTTCTCGAGAAATGCAGGATTCGTCTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020240.2-742s21c1
Sequence:CCGGGGAGACCTGTTCAGTGGAATGCTCGAGCATTCCACTGAACAGGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020240
CDC42SE2 MISSION shRNA Lentiviral Transduction Particles
CDC42 small effector 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-80s1c1
Sequence:CCGGGTATGATTGGAGAGCCCACAACTCGAGTTGTGGGCTCTCCAATCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-62s1c1
Sequence:CCGGGACGGCGGATTGACAGAAGTACTCGAGTACTTCTGTCAATCCGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-28s1c1
Sequence:CCGGTGCTGTATTGCAGAACAGCCTCTCGAGAGGCTGTTCTGCAATACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-66s1c1
Sequence:CCGGGCGGATTGACAGAAGTATGATCTCGAGATCATACTTCTGTCAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020240.1-91s1c1
Sequence:CCGGGAGCCCACAAACTTTGTGCATCTCGAGATGCACAAAGTTTGTGGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020240.2-771s21c1
Sequence:CCGGTAGCTCCATTCAGAACCAAATCTCGAGATTTGGTTCTGAATGGAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020240.2-903s21c1
Sequence:CCGGTCCACCCTGTCGTGATTATTCCTCGAGGAATAATCACGACAGGGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020240.2-794s21c1
Sequence:CCGGAGTCCAAGGGAGGTTATGGAGCTCGAGCTCCATAACCTCCCTTGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020240.2-960s21c1
Sequence:CCGGTGTCAGACGAATCCTGCATTTCTCGAGAAATGCAGGATTCGTCTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020240.2-742s21c1
Sequence:CCGGGGAGACCTGTTCAGTGGAATGCTCGAGCATTCCACTGAACAGGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)