EMAIL THIS PAGE TO A FRIEND

CDC45

cell division cycle 45

51 Gene Product Result for
Synonyms: CDC45L CDC45L2 PORC-PI-1
Gene ID:
Human(8318) Summary: The protein encoded by this gene was identified by its strong similarity with Saccharomyces cerevisiae Cdc45, an essential protein required to the initiation of DNA replication. Cdc45 is a member of the highly conserved multiprotein complex including Cdc6/Cdc18, the minichromosome maintenance proteins (MCMs) and DNA polymerase, which is important for early steps of DNA replication in eukaryotes. This protein has been shown to interact with MCM7 and DNA polymerase alpha. Studies of the similar gene in Xenopus suggested that this protein play a pivotal role in the loading of DNA polymerase alpha onto chromatin. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(12544) cell division cycle 45
Rat(287961) cell division cycle 45
Zebrafish(406695) CDC45 cell division cycle 45 homolog (S. cerevisiae)
cow(507122) cell division cycle 45 homolog (S. cerevisiae)
chicken(416776) cell division cycle 45 homolog (S. cerevisiae)
dog(486421) cell division cycle 45 homolog (S. cerevisiae)
Horse(100050871) cell division cycle 45 homolog (S. cerevisiae)
domestic cat(101097519) cell division cycle 45 homolog (S. cerevisiae)
Thale Cress(822101) cell division control protein 45
naked mole-rat(101714952) cell division cycle 45
domestic guinea pig(100728375) cell division cycle 45
sheep(101121376) cell division cycle 45 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003504 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003381 MISSION® esiRNA esiRNA targeting human CDC45L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003504 Rosetta Predictions human pricing
NM_001105866 Rosetta Predictions rat pricing
NM_009862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132444 predicted 346
2 SASI_Hs02_00335790 predicted 218
3 SASI_Hs01_00132445 predicted 381
4 SASI_Hs01_00132446 predicted 405
5 SASI_Hs01_00132447 predicted 1494
6 SASI_Hs02_00335791 predicted 628
7 SASI_Hs01_00132448 predicted 766
8 SASI_Hs01_00132451 predicted 290
9 SASI_Hs01_00132453 predicted 642
10 SASI_Hs02_00335792 predicted 1435
11 SASI_Hs01_00132449 predicted 534
12 SASI_Hs01_00132450 predicted 413
13 SASI_Hs01_00132452 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213302 predicted 590
2 SASI_Rn02_00213303 predicted 1625
3 SASI_Rn02_00213304 predicted 1101
4 SASI_Rn02_00213305 predicted 683
5 SASI_Rn02_00213306 predicted 319
6 SASI_Rn02_00213307 predicted 491
7 SASI_Rn02_00213308 predicted 566
8 SASI_Rn02_00213309 predicted 1446
9 SASI_Rn02_00213310 predicted 894
10 SASI_Rn02_00213311 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029610 predicted 877
2 SASI_Mm01_00029611 predicted 1193
3 SASI_Mm01_00029612 predicted 1386
4 SASI_Mm01_00029613 predicted 1199
5 SASI_Mm01_00029614 predicted 1197
6 SASI_Mm01_00029615 predicted 771
7 SASI_Mm01_00029616 predicted 1050
8 SASI_Mm01_00029617 predicted 1530
9 SASI_Mm01_00029618 predicted 1333
10 SASI_Mm02_00317292 predicted 633
11 SASI_Mm01_00029619 predicted 511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003504
VALIDATED
CDC45 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 45
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003504.3-214s21c1
Sequence:CCGGATATACGCTGGTTCCAGTTTCCTCGAGGAAACTGGAACCAGCGTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003504.3-406s21c1
Sequence:CCGGCAACGATACCCAGATCAAATTCTCGAGAATTTGATCTGGGTATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-383s1c1
Sequence:CCGGCCAGTCAATGTCGTCAATGTACTCGAGTACATTGACGACATTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-1740s1c1
Sequence:CCGGGCAAGTTTCTGGACGCACTTACTCGAGTAAGTGCGTCCAGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-614s1c1
Sequence:CCGGCGGAGAAGAGACATCCTCTTTCTCGAGAAAGAGGATGTCTCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-1150s1c1
Sequence:CCGGGCAGACTTTCAGCATTCATTTCTCGAGAAATGAATGCTGAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003504.3-241s1c1
Sequence:CCGGGCAAGAACTTGAAACTGCATTCTCGAGAATGCAGTTTCAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003504.3-311s1c1
Sequence:CCGGGCTAATGTAGACCTATTGGATCTCGAGATCCAATAGGTCTACATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003504.3-296s1c1
Sequence:CCGGCTCATAAACTGTGGAGCTAATCTCGAGATTAGCTCCACAGTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003504
VALIDATED
CDC45 MISSION shRNA shRNA Plasmid DNA
cell division cycle 45
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003504.3-214s21c1
Sequence:CCGGATATACGCTGGTTCCAGTTTCCTCGAGGAAACTGGAACCAGCGTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003504.3-406s21c1
Sequence:CCGGCAACGATACCCAGATCAAATTCTCGAGAATTTGATCTGGGTATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-383s1c1
Sequence:CCGGCCAGTCAATGTCGTCAATGTACTCGAGTACATTGACGACATTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-1740s1c1
Sequence:CCGGGCAAGTTTCTGGACGCACTTACTCGAGTAAGTGCGTCCAGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-614s1c1
Sequence:CCGGCGGAGAAGAGACATCCTCTTTCTCGAGAAAGAGGATGTCTCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-1150s1c1
Sequence:CCGGGCAGACTTTCAGCATTCATTTCTCGAGAAATGAATGCTGAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003504.3-241s1c1
Sequence:CCGGGCAAGAACTTGAAACTGCATTCTCGAGAATGCAGTTTCAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003504.3-311s1c1
Sequence:CCGGGCTAATGTAGACCTATTGGATCTCGAGATCCAATAGGTCTACATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003504.3-296s1c1
Sequence:CCGGCTCATAAACTGTGGAGCTAATCTCGAGATTAGCTCCACAGTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003504
VALIDATED
CDC45 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 45
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003504.3-214s21c1
Sequence:CCGGATATACGCTGGTTCCAGTTTCCTCGAGGAAACTGGAACCAGCGTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003504.3-406s21c1
Sequence:CCGGCAACGATACCCAGATCAAATTCTCGAGAATTTGATCTGGGTATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-383s1c1
Sequence:CCGGCCAGTCAATGTCGTCAATGTACTCGAGTACATTGACGACATTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-1740s1c1
Sequence:CCGGGCAAGTTTCTGGACGCACTTACTCGAGTAAGTGCGTCCAGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-614s1c1
Sequence:CCGGCGGAGAAGAGACATCCTCTTTCTCGAGAAAGAGGATGTCTCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003504.3-1150s1c1
Sequence:CCGGGCAGACTTTCAGCATTCATTTCTCGAGAAATGAATGCTGAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003504.3-241s1c1
Sequence:CCGGGCAAGAACTTGAAACTGCATTCTCGAGAATGCAGTTTCAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003504.3-311s1c1
Sequence:CCGGGCTAATGTAGACCTATTGGATCTCGAGATCCAATAGGTCTACATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003504.3-296s1c1
Sequence:CCGGCTCATAAACTGTGGAGCTAATCTCGAGATTAGCTCCACAGTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009862
VALIDATED
CDC45 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 45
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1741s21c1
Sequence:CCGGCTTTGTGTACTCGACAAAGAACTCGAGTTCTTTGTCGAGTACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1942s21c1
Sequence:CCGGCCTCTCAGTAATTGAGCTGAACTCGAGTTCAGCTCAATTACTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1403s21c1
Sequence:CCGGCAGTTTGGGTTCAAGCATAAACTCGAGTTTATGCTTGAACCCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-643s21c1
Sequence:CCGGCAATGACACTCAGATCAAATTCTCGAGAATTTGATCTGAGTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1051s21c1
Sequence:CCGGGCGTCATGTGTCCCGTCATAACTCGAGTTATGACGGGACACATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-478s1c1
Sequence:CCGGGCAAGAACTTGAAACTGCATACTCGAGTATGCAGTTTCAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-1741s1c1
Sequence:CCGGCTTTGTGTACTCGACAAAGAACTCGAGTTCTTTGTCGAGTACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-1942s1c1
Sequence:CCGGCCTCTCAGTAATTGAGCTGAACTCGAGTTCAGCTCAATTACTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-643s1c1
Sequence:CCGGCAATGACACTCAGATCAAATTCTCGAGAATTTGATCTGAGTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-479s1c1
Sequence:CCGGCAAGAACTTGAAACTGCATATCTCGAGATATGCAGTTTCAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009862
VALIDATED
CDC45 MISSION shRNA shRNA Plasmid DNA
cell division cycle 45
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1741s21c1
Sequence:CCGGCTTTGTGTACTCGACAAAGAACTCGAGTTCTTTGTCGAGTACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1942s21c1
Sequence:CCGGCCTCTCAGTAATTGAGCTGAACTCGAGTTCAGCTCAATTACTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1403s21c1
Sequence:CCGGCAGTTTGGGTTCAAGCATAAACTCGAGTTTATGCTTGAACCCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-643s21c1
Sequence:CCGGCAATGACACTCAGATCAAATTCTCGAGAATTTGATCTGAGTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1051s21c1
Sequence:CCGGGCGTCATGTGTCCCGTCATAACTCGAGTTATGACGGGACACATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-478s1c1
Sequence:CCGGGCAAGAACTTGAAACTGCATACTCGAGTATGCAGTTTCAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-1741s1c1
Sequence:CCGGCTTTGTGTACTCGACAAAGAACTCGAGTTCTTTGTCGAGTACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-1942s1c1
Sequence:CCGGCCTCTCAGTAATTGAGCTGAACTCGAGTTCAGCTCAATTACTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-643s1c1
Sequence:CCGGCAATGACACTCAGATCAAATTCTCGAGAATTTGATCTGAGTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-479s1c1
Sequence:CCGGCAAGAACTTGAAACTGCATATCTCGAGATATGCAGTTTCAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009862
VALIDATED
CDC45 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 45
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1741s21c1
Sequence:CCGGCTTTGTGTACTCGACAAAGAACTCGAGTTCTTTGTCGAGTACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1942s21c1
Sequence:CCGGCCTCTCAGTAATTGAGCTGAACTCGAGTTCAGCTCAATTACTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1403s21c1
Sequence:CCGGCAGTTTGGGTTCAAGCATAAACTCGAGTTTATGCTTGAACCCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-643s21c1
Sequence:CCGGCAATGACACTCAGATCAAATTCTCGAGAATTTGATCTGAGTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009862.1-1051s21c1
Sequence:CCGGGCGTCATGTGTCCCGTCATAACTCGAGTTATGACGGGACACATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-478s1c1
Sequence:CCGGGCAAGAACTTGAAACTGCATACTCGAGTATGCAGTTTCAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-1741s1c1
Sequence:CCGGCTTTGTGTACTCGACAAAGAACTCGAGTTCTTTGTCGAGTACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-1942s1c1
Sequence:CCGGCCTCTCAGTAATTGAGCTGAACTCGAGTTCAGCTCAATTACTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-643s1c1
Sequence:CCGGCAATGACACTCAGATCAAATTCTCGAGAATTTGATCTGAGTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009862.1-479s1c1
Sequence:CCGGCAAGAACTTGAAACTGCATATCTCGAGATATGCAGTTTCAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks