EMAIL THIS PAGE TO A FRIEND

CDC5L

cell division cycle 5-like

84 Gene Product Result for
Synonyms: CDC5 CDC5-LIKE CEF1 PCDC5RP dJ319D22.1
UniProtKB ID: Q99459, Q76N46, Q99974
Gene ID:
Human(988) Summary: The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Mouse(71702) cell division cycle 5-like (S. pombe)
Rat(85434) cell division cycle 5-like
Zebrafish(394059) CDC5 cell division cycle 5-like (S. pombe)
dog(474921) CDC5 cell division cycle 5-like (S. pombe)
domestic cat(101096809) CDC5 cell division cycle 5-like (S. pombe)
chicken(422052) CDC5 cell division cycle 5-like (S. pombe)
cow(767817) CDC5 cell division cycle 5-like (S. pombe)
Goat(100861007) CDC5 cell division cycle 5-like (S. pombe)
Domestic Rabbit(100340843) CDC5 cell division cycle 5-like (S. pombe)
sheep(101118824) CDC5 cell division cycle 5-like (S. pombe)
domestic guinea pig(100729105) cell division cycle 5-like
naked mole-rat(101726375) cell division cycle 5-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001253 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001253 Rosetta Predictions human pricing
NM_053527 Rosetta Predictions rat pricing
NM_152810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020232 predicted 600
2 SASI_Hs01_00020233 predicted 947
3 SASI_Hs01_00020234 predicted 1383
4 SASI_Hs01_00020235 predicted 499
5 SASI_Hs01_00020236 predicted 2026
6 SASI_Hs01_00020237 predicted 878
7 SASI_Hs01_00020238 predicted 1233
8 SASI_Hs01_00020239 predicted 1570
9 SASI_Hs01_00020240 predicted 1281
10 SASI_Hs01_00020241 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119792 predicted 1426
2 SASI_Rn01_00119793 predicted 1458
3 SASI_Rn01_00119794 predicted 1788
4 SASI_Rn01_00119795 predicted 1955
5 SASI_Rn01_00119796 predicted 200
6 SASI_Rn01_00119797 predicted 1111
7 SASI_Rn01_00119798 predicted 1443
8 SASI_Rn01_00119799 predicted 1565
9 SASI_Rn01_00119800 predicted 1610
10 SASI_Rn01_00119801 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342814 predicted 1972
2 SASI_Mm02_00342815 predicted 1965
3 SASI_Mm02_00342816 predicted 989
4 SASI_Mm01_00088551 predicted 331
5 SASI_Mm01_00088552 predicted 1633
6 SASI_Mm01_00088553 predicted 525
7 SASI_Mm01_00088554 predicted 380
8 SASI_Mm01_00088555 predicted 2610
9 SASI_Mm01_00088556 predicted 1770
10 SASI_Mm01_00088557 predicted 1624
11 SASI_Mm01_00088558 predicted 1807
12 SASI_Mm01_00088559 predicted 336
13 SASI_Mm01_00088560 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152810
VALIDATED
CDC5L MISSION shRNA Bacterial Glycerol Stock
cell division cycle 5-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152810.1-2845s1c1
Sequence:CCGGCCAGGATAATGAGGGTTTAAACTCGAGTTTAAACCCTCATTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152810.1-892s1c1
Sequence:CCGGGCGTTGATTATAATGCTGAAACTCGAGTTTCAGCATTATAATCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152810.1-375s1c1
Sequence:CCGGGCCTCATTGCTGCATAGGAAACTCGAGTTTCCTATGCAGCAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152810.1-1547s1c1
Sequence:CCGGCCGAAGTGGAACAACTCCTAACTCGAGTTAGGAGTTGTTCCACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152810.1-2092s1c1
Sequence:CCGGCCAACAATTCAGAGCACATTACTCGAGTAATGTGCTCTGAATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_152810.2-2092s21c1
Sequence:CCGGCCAACAATTCAGAGCACATTACTCGAGTAATGTGCTCTGAATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152810.2-1547s21c1
Sequence:CCGGCCGAAGTGGAACAACTCCTAACTCGAGTTAGGAGTTGTTCCACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_152810.2-1686s21c1
Sequence:CCGGTCTCGTGAACATCTCCGTTTACTCGAGTAAACGGAGATGTTCACGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152810.2-1696s21c1
Sequence:CCGGATCTCCGTTTAGGGTTGTTAGCTCGAGCTAACAACCCTAAACGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_152810.2-2845s21c1
Sequence:CCGGCCAGGATAATGAGGGTTTAAACTCGAGTTTAAACCCTCATTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152810
VALIDATED
CDC5L MISSION shRNA shRNA Plasmid DNA
cell division cycle 5-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152810.1-2845s1c1
Sequence:CCGGCCAGGATAATGAGGGTTTAAACTCGAGTTTAAACCCTCATTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152810.1-892s1c1
Sequence:CCGGGCGTTGATTATAATGCTGAAACTCGAGTTTCAGCATTATAATCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152810.1-375s1c1
Sequence:CCGGGCCTCATTGCTGCATAGGAAACTCGAGTTTCCTATGCAGCAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152810.1-1547s1c1
Sequence:CCGGCCGAAGTGGAACAACTCCTAACTCGAGTTAGGAGTTGTTCCACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152810.1-2092s1c1
Sequence:CCGGCCAACAATTCAGAGCACATTACTCGAGTAATGTGCTCTGAATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_152810.2-2092s21c1
Sequence:CCGGCCAACAATTCAGAGCACATTACTCGAGTAATGTGCTCTGAATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152810.2-1547s21c1
Sequence:CCGGCCGAAGTGGAACAACTCCTAACTCGAGTTAGGAGTTGTTCCACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_152810.2-1686s21c1
Sequence:CCGGTCTCGTGAACATCTCCGTTTACTCGAGTAAACGGAGATGTTCACGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152810.2-1696s21c1
Sequence:CCGGATCTCCGTTTAGGGTTGTTAGCTCGAGCTAACAACCCTAAACGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_152810.2-2845s21c1
Sequence:CCGGCCAGGATAATGAGGGTTTAAACTCGAGTTTAAACCCTCATTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152810
VALIDATED
CDC5L MISSION shRNA Lentiviral Transduction Particles
cell division cycle 5-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152810.1-2845s1c1
Sequence:CCGGCCAGGATAATGAGGGTTTAAACTCGAGTTTAAACCCTCATTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152810.1-892s1c1
Sequence:CCGGGCGTTGATTATAATGCTGAAACTCGAGTTTCAGCATTATAATCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152810.1-375s1c1
Sequence:CCGGGCCTCATTGCTGCATAGGAAACTCGAGTTTCCTATGCAGCAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152810.1-1547s1c1
Sequence:CCGGCCGAAGTGGAACAACTCCTAACTCGAGTTAGGAGTTGTTCCACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152810.1-2092s1c1
Sequence:CCGGCCAACAATTCAGAGCACATTACTCGAGTAATGTGCTCTGAATTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_152810.2-2092s21c1
Sequence:CCGGCCAACAATTCAGAGCACATTACTCGAGTAATGTGCTCTGAATTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152810.2-1547s21c1
Sequence:CCGGCCGAAGTGGAACAACTCCTAACTCGAGTTAGGAGTTGTTCCACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_152810.2-1686s21c1
Sequence:CCGGTCTCGTGAACATCTCCGTTTACTCGAGTAAACGGAGATGTTCACGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152810.2-1696s21c1
Sequence:CCGGATCTCCGTTTAGGGTTGTTAGCTCGAGCTAACAACCCTAAACGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_152810.2-2845s21c1
Sequence:CCGGCCAGGATAATGAGGGTTTAAACTCGAGTTTAAACCCTCATTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001253
VALIDATED
CDC5L MISSION shRNA Bacterial Glycerol Stock
cell division cycle 5-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-1230s1c1
Sequence:CCGGCCGAGGAATCTGGCATAACAACTCGAGTTGTTATGCCAGATTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-1894s1c1
Sequence:CCGGGCCAAGACCATCAGAAGTAAACTCGAGTTTACTTCTGATGGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001253.2-2727s1c1
Sequence:CCGGGCTGAAACTGATGTTTATCTTCTCGAGAAGATAAACATCAGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-323s1c1
Sequence:CCGGGCGGTAATGAAATATGGGAAACTCGAGTTTCCCATATTTCATTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-1205s1c1
Sequence:CCGGGCGAGTGAAATTGCACGTCAACTCGAGTTGACGTGCAATTTCACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001253.2-1205s21c1
Sequence:CCGGGCGAGTGAAATTGCACGTCAACTCGAGTTGACGTGCAATTTCACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001253.2-1230s21c1
Sequence:CCGGCCGAGGAATCTGGCATAACAACTCGAGTTGTTATGCCAGATTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001253.2-1894s21c1
Sequence:CCGGGCCAAGACCATCAGAAGTAAACTCGAGTTTACTTCTGATGGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001253.2-2727s21c1
Sequence:CCGGGCTGAAACTGATGTTTATCTTCTCGAGAAGATAAACATCAGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001253
VALIDATED
CDC5L MISSION shRNA shRNA Plasmid DNA
cell division cycle 5-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-1230s1c1
Sequence:CCGGCCGAGGAATCTGGCATAACAACTCGAGTTGTTATGCCAGATTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-1894s1c1
Sequence:CCGGGCCAAGACCATCAGAAGTAAACTCGAGTTTACTTCTGATGGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001253.2-2727s1c1
Sequence:CCGGGCTGAAACTGATGTTTATCTTCTCGAGAAGATAAACATCAGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-323s1c1
Sequence:CCGGGCGGTAATGAAATATGGGAAACTCGAGTTTCCCATATTTCATTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-1205s1c1
Sequence:CCGGGCGAGTGAAATTGCACGTCAACTCGAGTTGACGTGCAATTTCACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001253.2-1205s21c1
Sequence:CCGGGCGAGTGAAATTGCACGTCAACTCGAGTTGACGTGCAATTTCACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001253.2-1230s21c1
Sequence:CCGGCCGAGGAATCTGGCATAACAACTCGAGTTGTTATGCCAGATTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001253.2-1894s21c1
Sequence:CCGGGCCAAGACCATCAGAAGTAAACTCGAGTTTACTTCTGATGGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001253.2-2727s21c1
Sequence:CCGGGCTGAAACTGATGTTTATCTTCTCGAGAAGATAAACATCAGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001253
VALIDATED
CDC5L MISSION shRNA Lentiviral Transduction Particles
cell division cycle 5-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-1230s1c1
Sequence:CCGGCCGAGGAATCTGGCATAACAACTCGAGTTGTTATGCCAGATTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-1894s1c1
Sequence:CCGGGCCAAGACCATCAGAAGTAAACTCGAGTTTACTTCTGATGGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001253.2-2727s1c1
Sequence:CCGGGCTGAAACTGATGTTTATCTTCTCGAGAAGATAAACATCAGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-323s1c1
Sequence:CCGGGCGGTAATGAAATATGGGAAACTCGAGTTTCCCATATTTCATTACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001253.2-1205s1c1
Sequence:CCGGGCGAGTGAAATTGCACGTCAACTCGAGTTGACGTGCAATTTCACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001253.2-1205s21c1
Sequence:CCGGGCGAGTGAAATTGCACGTCAACTCGAGTTGACGTGCAATTTCACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001253.2-1230s21c1
Sequence:CCGGCCGAGGAATCTGGCATAACAACTCGAGTTGTTATGCCAGATTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001253.2-1894s21c1
Sequence:CCGGGCCAAGACCATCAGAAGTAAACTCGAGTTTACTTCTGATGGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001253.2-2727s21c1
Sequence:CCGGGCTGAAACTGATGTTTATCTTCTCGAGAAGATAAACATCAGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)