EMAIL THIS PAGE TO A FRIEND

CDC6

cell division cycle 6

126 Gene Product Result for
Synonyms: CDC18L HsCDC18 HsCDC6
UniProtKB ID: Q99741, Q8TB30
Gene ID:
Human(990) Summary: The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Cdc6, a protein essential for the initiation of DNA replication. This protein functions as a regulator at the early steps of DNA replication. It localizes in cell nucleus during cell cyle G1, but translocates to the cytoplasm at the start of S phase. The subcellular translocation of this protein during cell cyle is regulated through its phosphorylation by Cdks. Transcription of this protein was reported to be regulated in response to mitogenic signals through transcriptional control mechanism involving E2F proteins. [provided by RefSeq, Jul 2008]
Mouse(23834) cell division cycle 6
Rat(360621) cell division cycle 6
naked mole-rat(101724964) cell division cycle 6
domestic guinea pig(100729621) cell division cycle 6
sheep(101107536) cell division cycle 6 homolog (S. cerevisiae)
Domestic Rabbit(100357421) cell division cycle 6 homolog (S. cerevisiae)
Zebrafish(402825) cell division cycle 6 homolog (S. cerevisiae)
Thale Cress(817518) cell division control 6
dog(480527) cell division cycle 6 homolog (S. cerevisiae)
cow(515301) cell division cycle 6 homolog (S. cerevisiae)
Horse(100067788) cell division cycle 6 homolog (S. cerevisiae)
domestic cat(101082791) cell division cycle 6 homolog (S. cerevisiae)
fruit fly(38989) CG5971 gene product from transcript CG5971-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105026 Anti-CDC6 (21-31) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA050114 Anti-CDC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1411704 Anti-CDC6 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing
HPA054703 Anti-CDC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4503728 Anti-CDC6, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4503727 Anti-CDC6, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503859 Anti-phospho-CDC6 (pSer54) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
C0224 Monoclonal Anti-Cdc6 antibody produced in mouse clone DCS-180, ascites fluid human
immunoprecipitation, microarray, western blot pricing
PLA0257 Rabbit anti-CDC6 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chimpanzee, guinea pig, human, primate, dog, gibbon
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001254 Rosetta Predictions human pricing
NM_001108298 Rosetta Predictions rat pricing
NM_001025779 Rosetta Predictions mouse pricing
NM_011799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047246 predicted 892
2 SASI_Hs01_00047247 predicted 1123
3 SASI_Hs01_00047249 predicted 1312
4 SASI_Hs02_00331432 predicted 1818
5 SASI_Hs01_00047251 predicted 1442
6 SASI_Hs01_00047252 predicted 1610
7 SASI_Hs01_00047253 predicted 1584
8 SASI_Hs02_00331433 predicted 1286
9 SASI_Hs02_00331434 predicted 1279
10 SASI_Hs02_00331435 predicted 639
11 SASI_Hs01_00047245 predicted 673
12 SASI_Hs01_00047248 predicted 512
13 SASI_Hs01_00047250 predicted 1389
14 SASI_Hs01_00047254 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237279 predicted 1316
2 SASI_Rn02_00237280 predicted 1245
3 SASI_Rn02_00237281 predicted 1082
4 SASI_Rn02_00237282 predicted 1503
5 SASI_Rn02_00237283 predicted 618
6 SASI_Rn02_00237284 predicted 210
7 SASI_Rn02_00237285 predicted 1417
8 SASI_Rn02_00237286 predicted 1221
9 SASI_Rn02_00237287 predicted 1353
10 SASI_Rn02_00237288 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132221 predicted 1142
2 SASI_Mm01_00132222 predicted 1162
3 SASI_Mm01_00132223 predicted 990
4 SASI_Mm01_00132224 predicted 1336
5 SASI_Mm01_00132225 predicted 1183
6 SASI_Mm01_00132226 predicted 1406
7 SASI_Mm01_00132227 predicted 388
8 SASI_Mm01_00132228 predicted 1276
9 SASI_Mm01_00132229 predicted 1784
10 SASI_Mm01_00132230 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032533 predicted 1219
2 SASI_Mm01_00032534 predicted 1239
3 SASI_Mm01_00032535 predicted 1069
4 SASI_Mm01_00032536 predicted 1414
5 SASI_Mm01_00032537 predicted 1251
6 SASI_Mm01_00032538 predicted 1473
7 SASI_Mm01_00032539 predicted 466
8 SASI_Mm01_00032540 predicted 1352
9 SASI_Mm01_00032541 predicted 1865
10 SASI_Mm01_00032542 predicted 1078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001254
VALIDATED
CDC6 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 6
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-940s21c1
Sequence:CCGGCCAGCTATTGCTCAGGAGATTCTCGAGAATCTCCTGAGCAATAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-744s21c1
Sequence:CCGGGATGGATGTCATCAGGAATTTCTCGAGAAATTCCTGATGACATCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-271s21c1
Sequence:CCGGCGGGCATTGAACAAAGCTAAACTCGAGTTTAGCTTTGTTCAATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001254.3-2755s1c1
Sequence:CCGGGGGTCATAAGGAGACTATAACCTCGAGGTTATAGTCTCCTTATGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001254.3-2632s1c1
Sequence:CCGGATTTGGAGGACACTGGTTAAACTCGAGTTTAACCAGTGTCCTCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-304s21c1
Sequence:CCGGGCCAAACTAGAACCAACAAATCTCGAGATTTGTTGGTTCTAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001254.2-940s1c1
Sequence:CCGGCCAGCTATTGCTCAGGAGATTCTCGAGAATCTCCTGAGCAATAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001254.2-304s1c1
Sequence:CCGGGCCAAACTAGAACCAACAAATCTCGAGATTTGTTGGTTCTAGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001254.2-744s1c1
Sequence:CCGGGATGGATGTCATCAGGAATTTCTCGAGAAATTCCTGATGACATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001254.2-516s1c1
Sequence:CCGGGACAATTAAGTCTCCTAGCAACTCGAGTTGCTAGGAGACTTAATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001254.2-1443s1c1
Sequence:CCGGCAAACCACTGTCTGAATGTAACTCGAGTTACATTCAGACAGTGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001254.2-625s1c1
Sequence:CCGGCCACTGAAGAAAGAATCTGCACTCGAGTGCAGATTCTTTCTTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001254.2-1227s1c1
Sequence:CCGGGCTGTTGAACTTCCCACCTTACTCGAGTAAGGTGGGAAGTTCAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001254.2-271s1c1
Sequence:CCGGCGGGCATTGAACAAAGCTAAACTCGAGTTTAGCTTTGTTCAATGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001254
VALIDATED
CDC6 MISSION shRNA shRNA Plasmid DNA
cell division cycle 6
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-940s21c1
Sequence:CCGGCCAGCTATTGCTCAGGAGATTCTCGAGAATCTCCTGAGCAATAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-744s21c1
Sequence:CCGGGATGGATGTCATCAGGAATTTCTCGAGAAATTCCTGATGACATCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-271s21c1
Sequence:CCGGCGGGCATTGAACAAAGCTAAACTCGAGTTTAGCTTTGTTCAATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001254.3-2755s1c1
Sequence:CCGGGGGTCATAAGGAGACTATAACCTCGAGGTTATAGTCTCCTTATGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001254.3-2632s1c1
Sequence:CCGGATTTGGAGGACACTGGTTAAACTCGAGTTTAACCAGTGTCCTCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-304s21c1
Sequence:CCGGGCCAAACTAGAACCAACAAATCTCGAGATTTGTTGGTTCTAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001254.2-940s1c1
Sequence:CCGGCCAGCTATTGCTCAGGAGATTCTCGAGAATCTCCTGAGCAATAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001254.2-304s1c1
Sequence:CCGGGCCAAACTAGAACCAACAAATCTCGAGATTTGTTGGTTCTAGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001254.2-744s1c1
Sequence:CCGGGATGGATGTCATCAGGAATTTCTCGAGAAATTCCTGATGACATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001254.2-516s1c1
Sequence:CCGGGACAATTAAGTCTCCTAGCAACTCGAGTTGCTAGGAGACTTAATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001254.2-1443s1c1
Sequence:CCGGCAAACCACTGTCTGAATGTAACTCGAGTTACATTCAGACAGTGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001254.2-625s1c1
Sequence:CCGGCCACTGAAGAAAGAATCTGCACTCGAGTGCAGATTCTTTCTTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001254.2-1227s1c1
Sequence:CCGGGCTGTTGAACTTCCCACCTTACTCGAGTAAGGTGGGAAGTTCAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001254.2-271s1c1
Sequence:CCGGCGGGCATTGAACAAAGCTAAACTCGAGTTTAGCTTTGTTCAATGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001254
VALIDATED
CDC6 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 6
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-940s21c1
Sequence:CCGGCCAGCTATTGCTCAGGAGATTCTCGAGAATCTCCTGAGCAATAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-744s21c1
Sequence:CCGGGATGGATGTCATCAGGAATTTCTCGAGAAATTCCTGATGACATCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-271s21c1
Sequence:CCGGCGGGCATTGAACAAAGCTAAACTCGAGTTTAGCTTTGTTCAATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001254.3-2755s1c1
Sequence:CCGGGGGTCATAAGGAGACTATAACCTCGAGGTTATAGTCTCCTTATGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001254.3-2632s1c1
Sequence:CCGGATTTGGAGGACACTGGTTAAACTCGAGTTTAACCAGTGTCCTCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001254.3-304s21c1
Sequence:CCGGGCCAAACTAGAACCAACAAATCTCGAGATTTGTTGGTTCTAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001254.2-940s1c1
Sequence:CCGGCCAGCTATTGCTCAGGAGATTCTCGAGAATCTCCTGAGCAATAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001254.2-304s1c1
Sequence:CCGGGCCAAACTAGAACCAACAAATCTCGAGATTTGTTGGTTCTAGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001254.2-744s1c1
Sequence:CCGGGATGGATGTCATCAGGAATTTCTCGAGAAATTCCTGATGACATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001254.2-516s1c1
Sequence:CCGGGACAATTAAGTCTCCTAGCAACTCGAGTTGCTAGGAGACTTAATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001254.2-1443s1c1
Sequence:CCGGCAAACCACTGTCTGAATGTAACTCGAGTTACATTCAGACAGTGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001254.2-625s1c1
Sequence:CCGGCCACTGAAGAAAGAATCTGCACTCGAGTGCAGATTCTTTCTTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001254.2-1227s1c1
Sequence:CCGGGCTGTTGAACTTCCCACCTTACTCGAGTAAGGTGGGAAGTTCAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001254.2-271s1c1
Sequence:CCGGCGGGCATTGAACAAAGCTAAACTCGAGTTTAGCTTTGTTCAATGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011799
CDC6 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011799.2-3395s1c1
Sequence:CCGGGCCTGCACATTATCCTTGTAACTCGAGTTACAAGGATAATGTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-1688s1c1
Sequence:CCGGCGTAGACCAGTCTGAGTGTTTCTCGAGAAACACTCAGACTGGTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-1116s1c1
Sequence:CCGGCGATTGGTGCTCATTGGTATTCTCGAGAATACCAATGAGCACCAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-918s1c1
Sequence:CCGGCCAGCTATTGCTCAGGAGATTCTCGAGAATCTCCTGAGCAATAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-236s1c1
Sequence:CCGGGCTATCTAATACCCTGAAGAACTCGAGTTCTTCAGGGTATTAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011799
CDC6 MISSION shRNA shRNA Plasmid DNA
cell division cycle 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011799.2-3395s1c1
Sequence:CCGGGCCTGCACATTATCCTTGTAACTCGAGTTACAAGGATAATGTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-1688s1c1
Sequence:CCGGCGTAGACCAGTCTGAGTGTTTCTCGAGAAACACTCAGACTGGTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-1116s1c1
Sequence:CCGGCGATTGGTGCTCATTGGTATTCTCGAGAATACCAATGAGCACCAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-918s1c1
Sequence:CCGGCCAGCTATTGCTCAGGAGATTCTCGAGAATCTCCTGAGCAATAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-236s1c1
Sequence:CCGGGCTATCTAATACCCTGAAGAACTCGAGTTCTTCAGGGTATTAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011799
CDC6 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011799.2-3395s1c1
Sequence:CCGGGCCTGCACATTATCCTTGTAACTCGAGTTACAAGGATAATGTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-1688s1c1
Sequence:CCGGCGTAGACCAGTCTGAGTGTTTCTCGAGAAACACTCAGACTGGTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-1116s1c1
Sequence:CCGGCGATTGGTGCTCATTGGTATTCTCGAGAATACCAATGAGCACCAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-918s1c1
Sequence:CCGGCCAGCTATTGCTCAGGAGATTCTCGAGAATCTCCTGAGCAATAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011799.2-236s1c1
Sequence:CCGGGCTATCTAATACCCTGAAGAACTCGAGTTCTTCAGGGTATTAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)