EMAIL THIS PAGE TO A FRIEND

CDC73

cell division cycle 73

126 Gene Product Result for
Synonyms: C1orf28 HPTJT HRPT2 HYX
Gene ID:
Human(79577) Summary: This gene encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone methyltransferase complex. This protein appears to facilitate the association of 3' mRNA processing factors with actively-transcribed chromatin. Mutations in this gene have been linked to hyperparathyroidism-jaw tumor syndrome, familial isolated hyperparathyroidism, and parathyroid carcinoma. [provided by RefSeq, Jul 2009]
Mouse(214498) cell division cycle 73, Paf1/RNA polymerase II complex component
Rat(304832) cell division cycle 73
naked mole-rat(101726604) cell division cycle 73
domestic guinea pig(100735298) cell division cycle 73
sheep(101118545) cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Zebrafish(393319) cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
chicken(424356) cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
dog(478955) cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Horse(100059715) cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
cow(100139547) cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
domestic cat(101090918) cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024529 siRNAs that have been validated in the lab human pricing
NM_001024769 Rosetta Predictions rat pricing
NM_145991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024529 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126024 validated 666
2 SASI_Hs01_00126025 predicted 422
3 SASI_Hs02_00356821 predicted 579
4 SASI_Hs01_00126026 predicted 817
5 SASI_Hs02_00356822 predicted 1276
6 SASI_Hs01_00126028 predicted 1644
7 SASI_Hs01_00126029 predicted 570
8 SASI_Hs01_00126030 predicted 1680
9 SASI_Hs01_00126031 predicted 1604
10 SASI_Hs01_00126032 predicted 851
11 SASI_Hs01_00126027 predicted 1802
12 SASI_Hs01_00126033 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038239 predicted 1700
2 SASI_Rn01_00038240 predicted 752
3 SASI_Rn02_00202652 predicted 1510
4 SASI_Rn01_00038241 predicted 1088
5 SASI_Rn01_00038242 predicted 306
6 SASI_Rn01_00038244 predicted 1756
7 SASI_Rn01_00038245 predicted 1571
8 SASI_Rn02_00202653 predicted 1787
9 SASI_Rn01_00038247 predicted 1569
10 SASI_Rn02_00202654 predicted 534
11 SASI_Rn01_00038243 predicted 400
12 SASI_Rn01_00038246 predicted 1613
13 SASI_Rn01_00038248 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183936 predicted 677
2 SASI_Mm01_00183937 predicted 1642
3 SASI_Mm02_00341507 predicted 718
4 SASI_Mm01_00183938 predicted 1728
5 SASI_Mm01_00183939 predicted 1721
6 SASI_Mm01_00183940 predicted 1500
7 SASI_Mm01_00183941 predicted 311
8 SASI_Mm01_00183942 predicted 1698
9 SASI_Mm01_00183943 predicted 1611
10 SASI_Mm01_00183944 predicted 467
11 SASI_Mm01_00183945 predicted 1502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024529
VALIDATED
CDC73 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 73
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-1629s21c1
Sequence:CCGGTGATGGATCACCAGTTGATATCTCGAGATATCAACTGGTGATCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024529.4-2076s21c1
Sequence:CCGGCCATTGGTTAAATTAGCATTACTCGAGTAATGCTAATTTAACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-851s21c1
Sequence:CCGGATGACATAACTGCCCTTAAACCTCGAGGTTTAAGGGCAGTTATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-742s21c1
Sequence:CCGGACTGAACAGATTAGGTCTTTGCTCGAGCAAAGACCTAATCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-1802s21c1
Sequence:CCGGGGTACATGGTAAAGCATAAATCTCGAGATTTATGCTTTACCATGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-474s1c1
Sequence:CCGGGCGTCAACATCGGCAAGTATACTCGAGTATACTTGCCGATGTTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024529.3-2409s1c1
Sequence:CCGGCCTAGAATGATGTGTTTCTATCTCGAGATAGAAACACATCATTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-1032s1c1
Sequence:CCGGGCTGCCTATAACAGATACGATCTCGAGATCGTATCTGTTATAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-1276s1c1
Sequence:CCGGCCTCTTTAATAACCATGCTTACTCGAGTAAGCATGGTTATTAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-504s1c1
Sequence:CCGGGCTCCCTTAGAAATAGGTCTTCTCGAGAAGACCTATTTCTAAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024529
VALIDATED
CDC73 MISSION shRNA shRNA Plasmid DNA
cell division cycle 73
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-1629s21c1
Sequence:CCGGTGATGGATCACCAGTTGATATCTCGAGATATCAACTGGTGATCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024529.4-2076s21c1
Sequence:CCGGCCATTGGTTAAATTAGCATTACTCGAGTAATGCTAATTTAACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-851s21c1
Sequence:CCGGATGACATAACTGCCCTTAAACCTCGAGGTTTAAGGGCAGTTATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-742s21c1
Sequence:CCGGACTGAACAGATTAGGTCTTTGCTCGAGCAAAGACCTAATCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-1802s21c1
Sequence:CCGGGGTACATGGTAAAGCATAAATCTCGAGATTTATGCTTTACCATGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-474s1c1
Sequence:CCGGGCGTCAACATCGGCAAGTATACTCGAGTATACTTGCCGATGTTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024529.3-2409s1c1
Sequence:CCGGCCTAGAATGATGTGTTTCTATCTCGAGATAGAAACACATCATTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-1032s1c1
Sequence:CCGGGCTGCCTATAACAGATACGATCTCGAGATCGTATCTGTTATAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-1276s1c1
Sequence:CCGGCCTCTTTAATAACCATGCTTACTCGAGTAAGCATGGTTATTAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-504s1c1
Sequence:CCGGGCTCCCTTAGAAATAGGTCTTCTCGAGAAGACCTATTTCTAAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024529
VALIDATED
CDC73 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 73
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-1629s21c1
Sequence:CCGGTGATGGATCACCAGTTGATATCTCGAGATATCAACTGGTGATCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024529.4-2076s21c1
Sequence:CCGGCCATTGGTTAAATTAGCATTACTCGAGTAATGCTAATTTAACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-851s21c1
Sequence:CCGGATGACATAACTGCCCTTAAACCTCGAGGTTTAAGGGCAGTTATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-742s21c1
Sequence:CCGGACTGAACAGATTAGGTCTTTGCTCGAGCAAAGACCTAATCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024529.4-1802s21c1
Sequence:CCGGGGTACATGGTAAAGCATAAATCTCGAGATTTATGCTTTACCATGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-474s1c1
Sequence:CCGGGCGTCAACATCGGCAAGTATACTCGAGTATACTTGCCGATGTTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024529.3-2409s1c1
Sequence:CCGGCCTAGAATGATGTGTTTCTATCTCGAGATAGAAACACATCATTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-1032s1c1
Sequence:CCGGGCTGCCTATAACAGATACGATCTCGAGATCGTATCTGTTATAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-1276s1c1
Sequence:CCGGCCTCTTTAATAACCATGCTTACTCGAGTAAGCATGGTTATTAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024529.3-504s1c1
Sequence:CCGGGCTCCCTTAGAAATAGGTCTTCTCGAGAAGACCTATTTCTAAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145991
VALIDATED
CDC73 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 73
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-2074s21c1
Sequence:CCGGATACTGTCATGATGGTATTAACTCGAGTTAATACCATCATGACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145991.1-2452s1c1
Sequence:CCGGGATGAGTGTGTGTCAACATAGCTCGAGCTATGTTGACACACACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145991.1-1126s21c1
Sequence:CCGGGGGTCACGGACACCCATTATTCTCGAGAATAATGGGTGTCCGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-1548s21c1
Sequence:CCGGATTAGAACTCAGCTATCATAACTCGAGTTATGATAGCTGAGTTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-1450s21c1
Sequence:CCGGGGATCACCAGTTGACATATTTCTCGAGAAATATGTCAACTGGTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-524s21c1
Sequence:CCGGCTCGTTTGGAAGGCCATAAAGCTCGAGCTTTATGGCCTTCCAAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145991.1-1483s1c1
Sequence:CCGGGCCTTCCATCTCAAGTATGATCTCGAGATCATACTTGAGATGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145991.1-498s1c1
Sequence:CCGGGCGCCTTGATAAAGAGAGATTCTCGAGAATCTCTCTTTATCAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145991
VALIDATED
CDC73 MISSION shRNA shRNA Plasmid DNA
cell division cycle 73
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-2074s21c1
Sequence:CCGGATACTGTCATGATGGTATTAACTCGAGTTAATACCATCATGACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145991.1-2452s1c1
Sequence:CCGGGATGAGTGTGTGTCAACATAGCTCGAGCTATGTTGACACACACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145991.1-1126s21c1
Sequence:CCGGGGGTCACGGACACCCATTATTCTCGAGAATAATGGGTGTCCGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-1548s21c1
Sequence:CCGGATTAGAACTCAGCTATCATAACTCGAGTTATGATAGCTGAGTTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-1450s21c1
Sequence:CCGGGGATCACCAGTTGACATATTTCTCGAGAAATATGTCAACTGGTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-524s21c1
Sequence:CCGGCTCGTTTGGAAGGCCATAAAGCTCGAGCTTTATGGCCTTCCAAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145991.1-1483s1c1
Sequence:CCGGGCCTTCCATCTCAAGTATGATCTCGAGATCATACTTGAGATGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145991.1-498s1c1
Sequence:CCGGGCGCCTTGATAAAGAGAGATTCTCGAGAATCTCTCTTTATCAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145991
VALIDATED
CDC73 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 73
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-2074s21c1
Sequence:CCGGATACTGTCATGATGGTATTAACTCGAGTTAATACCATCATGACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145991.1-2452s1c1
Sequence:CCGGGATGAGTGTGTGTCAACATAGCTCGAGCTATGTTGACACACACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145991.1-1126s21c1
Sequence:CCGGGGGTCACGGACACCCATTATTCTCGAGAATAATGGGTGTCCGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-1548s21c1
Sequence:CCGGATTAGAACTCAGCTATCATAACTCGAGTTATGATAGCTGAGTTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-1450s21c1
Sequence:CCGGGGATCACCAGTTGACATATTTCTCGAGAAATATGTCAACTGGTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145991.1-524s21c1
Sequence:CCGGCTCGTTTGGAAGGCCATAAAGCTCGAGCTTTATGGCCTTCCAAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145991.1-1483s1c1
Sequence:CCGGGCCTTCCATCTCAAGTATGATCTCGAGATCATACTTGAGATGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145991.1-498s1c1
Sequence:CCGGGCGCCTTGATAAAGAGAGATTCTCGAGAATCTCTCTTTATCAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks