EMAIL THIS PAGE TO A FRIEND

CDC7

cell division cycle 7

75 Gene Product Result for
Synonyms: CDC7L1 HsCDC7 Hsk1 huCDC7
UniProtKB ID: O00311, D3DT31, O00558, Q5T5U5
Gene ID:
Human(8317) Summary: This gene encodes a cell division cycle protein with kinase activity that is critical for the G1/S transition. The yeast homolog is also essential for initiation of DNA replication as cell division occurs. Overexpression of this gene product may be associated with neoplastic transformation for some tumors. Multiple alternatively spliced transcript variants that encode the same protein have been detected. [provided by RefSeq, Aug 2008]
Mouse(12545) cell division cycle 7 (S. cerevisiae)
Rat(360908) cell division cycle 7
Zebrafish(492768) cell division cycle 7 homolog (S. cerevisiae)
cow(516094) cell division cycle 7 homolog (S. cerevisiae)
Horse(100060468) cell division cycle 7 homolog (S. cerevisiae)
domestic cat(101085227) cell division cycle 7 homolog (S. cerevisiae)
dog(479955) cell division cycle 7 homolog (S. cerevisiae)
chicken(424507) cell division cycle 7 homolog (S. cerevisiae)
sheep(101102190) cell division cycle 7 homolog (S. cerevisiae)
domestic guinea pig(100716321) cell division cycle 7
naked mole-rat(101720948) cell division cycle 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012161 MISSION® esiRNA esiRNA targeting human CDC7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003503 siRNAs that have been validated in the lab human pricing
NM_001108352 Rosetta Predictions rat pricing
NM_009863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003503 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097148 validated 1050
1 SASI_Hs01_00097147 validated 462
2 SASI_Hs01_00097146 predicted 494
3 SASI_Hs02_00335785 predicted 760
4 SASI_Hs01_00097151 predicted 1343
5 SASI_Hs02_00335786 predicted 1073
6 SASI_Hs01_00097155 predicted 1174
7 SASI_Hs02_00335787 predicted 909
8 SASI_Hs02_00335788 predicted 632
9 SASI_Hs02_00335789 predicted 1070
10 SASI_Hs01_00097149 predicted 1834
11 SASI_Hs01_00097150 predicted 1048
12 SASI_Hs01_00097152 predicted 481
13 SASI_Hs01_00097153 predicted 1745
14 SASI_Hs01_00097154 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237819 predicted 1239
2 SASI_Rn02_00237820 predicted 1989
3 SASI_Rn02_00237821 predicted 954
4 SASI_Rn02_00237822 predicted 1596
5 SASI_Rn02_00237823 predicted 844
6 SASI_Rn02_00237824 predicted 1226
7 SASI_Rn02_00237825 predicted 792
8 SASI_Rn02_00237826 predicted 825
9 SASI_Rn02_00237827 predicted 1467
10 SASI_Rn02_00237828 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074975 predicted 983
2 SASI_Mm01_00074976 predicted 516
3 SASI_Mm01_00074977 predicted 620
4 SASI_Mm02_00317293 predicted 1712
5 SASI_Mm01_00074979 predicted 1704
6 SASI_Mm02_00317294 predicted 374
7 SASI_Mm02_00317295 predicted 1224
8 SASI_Mm01_00074980 predicted 1873
9 SASI_Mm01_00074981 predicted 1115
10 SASI_Mm01_00074982 predicted 947
11 SASI_Mm01_00074978 predicted 1962
12 SASI_Mm01_00074983 predicted 1464
13 SASI_Mm01_00074984 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003503
VALIDATED
CDC7 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 7
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003503.2-2951s1c1
Sequence:CCGGGCTGACAGATTTCCCATTTAGCTCGAGCTAAATGGGAAATCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003503.2-1291s1c1
Sequence:CCGGCCAATCAAACTACAGCAATTGCTCGAGCAATTGCTGTAGTTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196543    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003503.2-2734s1c1
Sequence:CCGGGAATACAGAATTGACGGTATTCTCGAGAATACCGTCAATTCTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003503.2-1809s1c1
Sequence:CCGGGAAGCTTTGTTGCATCCATTTCTCGAGAAATGGATGCAACAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003503.x-348s1c1
Sequence:CCGGGCCACAGCACAGTTACAAGTACTCGAGTACTTGTAACTGTGCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003503.x-651s1c1
Sequence:CCGGCGTGATGTTAAGCCCAGCAATCTCGAGATTGCTGGGCTTAACATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003503.x-1638s1c1
Sequence:CCGGCCAGGACAATACTCAGGGAATCTCGAGATTCCCTGAGTATTGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003503.x-624s1c1
Sequence:CCGGCGCATTCATCAGTTTGGTATTCTCGAGAATACCAAACTGATGAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003503.x-3049s1c1
Sequence:CCGGCCTAATCTGTTTGGTAAGTATCTCGAGATACTTACCAAACAGATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-313s21c1
Sequence:GTACCGGGCTGTACCACAGCTTAGTAATCTCGAGATTACTAAGCTGTGGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-388s21c1
Sequence:CCGGGCCACAGCACAGTTACAAGTACTCGAGTACTTGTAACTGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-1849s21c1
Sequence:CCGGGAAGCTTTGTTGCATCCATTTCTCGAGAAATGGATGCAACAAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-664s21c1
Sequence:CCGGCGCATTCATCAGTTTGGTATTCTCGAGAATACCAAACTGATGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003503.3-1970s21c1
Sequence:CCGGAGAGACCAGAGCAGGATTAATCTCGAGATTAATCCTGCTCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003503.3-617s21c1
Sequence:CCGGTTCAAGAAGTACGGGAATATACTCGAGTATATTCCCGTACTTCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003503
VALIDATED
CDC7 MISSION shRNA shRNA Plasmid DNA
cell division cycle 7
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003503.2-2951s1c1
Sequence:CCGGGCTGACAGATTTCCCATTTAGCTCGAGCTAAATGGGAAATCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003503.2-1291s1c1
Sequence:CCGGCCAATCAAACTACAGCAATTGCTCGAGCAATTGCTGTAGTTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196543    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003503.2-2734s1c1
Sequence:CCGGGAATACAGAATTGACGGTATTCTCGAGAATACCGTCAATTCTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003503.2-1809s1c1
Sequence:CCGGGAAGCTTTGTTGCATCCATTTCTCGAGAAATGGATGCAACAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003503.x-348s1c1
Sequence:CCGGGCCACAGCACAGTTACAAGTACTCGAGTACTTGTAACTGTGCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003503.x-651s1c1
Sequence:CCGGCGTGATGTTAAGCCCAGCAATCTCGAGATTGCTGGGCTTAACATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003503.x-1638s1c1
Sequence:CCGGCCAGGACAATACTCAGGGAATCTCGAGATTCCCTGAGTATTGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003503.x-624s1c1
Sequence:CCGGCGCATTCATCAGTTTGGTATTCTCGAGAATACCAAACTGATGAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003503.x-3049s1c1
Sequence:CCGGCCTAATCTGTTTGGTAAGTATCTCGAGATACTTACCAAACAGATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-313s21c1
Sequence:GTACCGGGCTGTACCACAGCTTAGTAATCTCGAGATTACTAAGCTGTGGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-388s21c1
Sequence:CCGGGCCACAGCACAGTTACAAGTACTCGAGTACTTGTAACTGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-1849s21c1
Sequence:CCGGGAAGCTTTGTTGCATCCATTTCTCGAGAAATGGATGCAACAAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-664s21c1
Sequence:CCGGCGCATTCATCAGTTTGGTATTCTCGAGAATACCAAACTGATGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003503.3-1970s21c1
Sequence:CCGGAGAGACCAGAGCAGGATTAATCTCGAGATTAATCCTGCTCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003503.3-617s21c1
Sequence:CCGGTTCAAGAAGTACGGGAATATACTCGAGTATATTCCCGTACTTCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003503
VALIDATED
CDC7 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 7
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003503.2-2951s1c1
Sequence:CCGGGCTGACAGATTTCCCATTTAGCTCGAGCTAAATGGGAAATCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003503.2-1291s1c1
Sequence:CCGGCCAATCAAACTACAGCAATTGCTCGAGCAATTGCTGTAGTTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196543    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003503.2-2734s1c1
Sequence:CCGGGAATACAGAATTGACGGTATTCTCGAGAATACCGTCAATTCTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003503.2-1809s1c1
Sequence:CCGGGAAGCTTTGTTGCATCCATTTCTCGAGAAATGGATGCAACAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003503.x-348s1c1
Sequence:CCGGGCCACAGCACAGTTACAAGTACTCGAGTACTTGTAACTGTGCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003503.x-651s1c1
Sequence:CCGGCGTGATGTTAAGCCCAGCAATCTCGAGATTGCTGGGCTTAACATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003503.x-1638s1c1
Sequence:CCGGCCAGGACAATACTCAGGGAATCTCGAGATTCCCTGAGTATTGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003503.x-624s1c1
Sequence:CCGGCGCATTCATCAGTTTGGTATTCTCGAGAATACCAAACTGATGAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003503.x-3049s1c1
Sequence:CCGGCCTAATCTGTTTGGTAAGTATCTCGAGATACTTACCAAACAGATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-313s21c1
Sequence:GTACCGGGCTGTACCACAGCTTAGTAATCTCGAGATTACTAAGCTGTGGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-388s21c1
Sequence:CCGGGCCACAGCACAGTTACAAGTACTCGAGTACTTGTAACTGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-1849s21c1
Sequence:CCGGGAAGCTTTGTTGCATCCATTTCTCGAGAAATGGATGCAACAAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003503.3-664s21c1
Sequence:CCGGCGCATTCATCAGTTTGGTATTCTCGAGAATACCAAACTGATGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003503.3-1970s21c1
Sequence:CCGGAGAGACCAGAGCAGGATTAATCTCGAGATTAATCCTGCTCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003503.3-617s21c1
Sequence:CCGGTTCAAGAAGTACGGGAATATACTCGAGTATATTCCCGTACTTCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009863
VALIDATED
CDC7 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-1823s1c1
Sequence:CCGGGCTTCAAGGATAACAGCAGAACTCGAGTTCTGCTGTTATCCTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-1215s1c1
Sequence:CCGGGCGACTGCTATGGATCAAATACTCGAGTATTTGATCCATAGCAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-659s1c1
Sequence:CCGGGTAGCTTTGAAACGGATTCATCTCGAGATGAATCCGTTTCAAAGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-829s1c1
Sequence:CCGGGCAGGAAGATTGTTCACGAAACTCGAGTTTCGTGAACAATCTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-1093s1c1
Sequence:CCGGGCAATCAAAGACTGTGGACATCTCGAGATGTCCACAGTCTTTGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-1798s21c1
Sequence:CCGGGACAAGCTTCTGGACCTAAACCTCGAGGTTTAGGTCCAGAAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-1847s21c1
Sequence:CCGGCCTTATTACATGCGTTCTTTACTCGAGTAAAGAACGCATGTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-236s21c1
Sequence:CCGGGTCCGGCTGATGACTCTTTAACTCGAGTTAAAGAGTCATCAGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-1930s21c1
Sequence:CCGGTGGATAATCACAGGTTGTTTGCTCGAGCAAACAACCTGTGATTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-272s21c1
Sequence:CCGGGTGTTAAACTTTCAGGTATTACTCGAGTAATACCTGAAAGTTTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-2155s21c1
Sequence:CCGGTTCGAGGTACAGGTCATAAAGCTCGAGCTTTATGACCTGTACCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009863
VALIDATED
CDC7 MISSION shRNA shRNA Plasmid DNA
cell division cycle 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-1823s1c1
Sequence:CCGGGCTTCAAGGATAACAGCAGAACTCGAGTTCTGCTGTTATCCTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-1215s1c1
Sequence:CCGGGCGACTGCTATGGATCAAATACTCGAGTATTTGATCCATAGCAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-659s1c1
Sequence:CCGGGTAGCTTTGAAACGGATTCATCTCGAGATGAATCCGTTTCAAAGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-829s1c1
Sequence:CCGGGCAGGAAGATTGTTCACGAAACTCGAGTTTCGTGAACAATCTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-1093s1c1
Sequence:CCGGGCAATCAAAGACTGTGGACATCTCGAGATGTCCACAGTCTTTGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-1798s21c1
Sequence:CCGGGACAAGCTTCTGGACCTAAACCTCGAGGTTTAGGTCCAGAAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-1847s21c1
Sequence:CCGGCCTTATTACATGCGTTCTTTACTCGAGTAAAGAACGCATGTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-236s21c1
Sequence:CCGGGTCCGGCTGATGACTCTTTAACTCGAGTTAAAGAGTCATCAGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-1930s21c1
Sequence:CCGGTGGATAATCACAGGTTGTTTGCTCGAGCAAACAACCTGTGATTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-272s21c1
Sequence:CCGGGTGTTAAACTTTCAGGTATTACTCGAGTAATACCTGAAAGTTTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-2155s21c1
Sequence:CCGGTTCGAGGTACAGGTCATAAAGCTCGAGCTTTATGACCTGTACCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009863
VALIDATED
CDC7 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-1823s1c1
Sequence:CCGGGCTTCAAGGATAACAGCAGAACTCGAGTTCTGCTGTTATCCTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-1215s1c1
Sequence:CCGGGCGACTGCTATGGATCAAATACTCGAGTATTTGATCCATAGCAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-659s1c1
Sequence:CCGGGTAGCTTTGAAACGGATTCATCTCGAGATGAATCCGTTTCAAAGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-829s1c1
Sequence:CCGGGCAGGAAGATTGTTCACGAAACTCGAGTTTCGTGAACAATCTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009863.1-1093s1c1
Sequence:CCGGGCAATCAAAGACTGTGGACATCTCGAGATGTCCACAGTCTTTGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-1798s21c1
Sequence:CCGGGACAAGCTTCTGGACCTAAACCTCGAGGTTTAGGTCCAGAAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-1847s21c1
Sequence:CCGGCCTTATTACATGCGTTCTTTACTCGAGTAAAGAACGCATGTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-236s21c1
Sequence:CCGGGTCCGGCTGATGACTCTTTAACTCGAGTTAAAGAGTCATCAGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-1930s21c1
Sequence:CCGGTGGATAATCACAGGTTGTTTGCTCGAGCAAACAACCTGTGATTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-272s21c1
Sequence:CCGGGTGTTAAACTTTCAGGTATTACTCGAGTAATACCTGAAAGTTTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009863.2-2155s21c1
Sequence:CCGGTTCGAGGTACAGGTCATAAAGCTCGAGCTTTATGACCTGTACCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks