EMAIL THIS PAGE TO A FRIEND

CDCA2

cell division cycle associated 2

61 Gene Product Result for
Synonyms: Repo-Man
Gene ID:
Mouse(108912) cell division cycle associated 2
Rat(305984) cell division cycle associated 2
chicken(419524) cell division cycle associated 2
cow(515287) cell division cycle associated 2
Horse(100059371) cell division cycle associated 2
domestic cat(101081798) cell division cycle associated 2
dog(477377) cell division cycle associated 2
sheep(101111159) cell division cycle associated 2
domestic guinea pig(100733006) cell division cycle associated 2
naked mole-rat(101706363) cell division cycle associated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152562 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045441 MISSION® esiRNA esiRNA human CDCA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152562 Rosetta Predictions human pricing
NM_001107273 Rosetta Predictions rat pricing
NM_001110162 Rosetta Predictions mouse pricing
NM_175384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211881 predicted 1697
2 SASI_Hs01_00211882 predicted 3268
3 SASI_Hs01_00211883 predicted 876
4 SASI_Hs01_00211885 predicted 1442
5 SASI_Hs01_00211886 predicted 3449
6 SASI_Hs01_00211887 predicted 1843
7 SASI_Hs01_00211888 predicted 1661
8 SASI_Hs01_00211889 predicted 1918
9 SASI_Hs01_00211890 predicted 589
10 SASI_Hs02_00366376 predicted 1461
11 SASI_Hs01_00211884 predicted 1895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227215 predicted 2397
2 SASI_Rn02_00227216 predicted 2686
3 SASI_Rn02_00227217 predicted 2586
4 SASI_Rn02_00227218 predicted 2065
5 SASI_Rn02_00227219 predicted 1306
6 SASI_Rn02_00227220 predicted 1340
7 SASI_Rn02_00227221 predicted 1498
8 SASI_Rn02_00227222 predicted 991
9 SASI_Rn02_00227223 predicted 2258
10 SASI_Rn02_00227224 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304806 predicted 1660
2 SASI_Mm02_00304807 predicted 2575
3 SASI_Mm02_00304808 predicted 910
4 SASI_Mm02_00304809 predicted 583
5 SASI_Mm02_00304810 predicted 1540
6 SASI_Mm02_00304811 predicted 1746
7 SASI_Mm02_00304812 predicted 1576
8 SASI_Mm02_00304813 predicted 1572
9 SASI_Mm02_00304814 predicted 903
10 SASI_Mm02_00304815 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123182 predicted 1360
2 SASI_Mm01_00123183 predicted 2278
3 SASI_Mm02_00346214 predicted 612
4 SASI_Mm02_00346215 predicted 286
5 SASI_Mm02_00346216 predicted 1246
6 SASI_Mm01_00123185 predicted 1449
7 SASI_Mm01_00123187 predicted 1280
8 SASI_Mm01_00123188 predicted 1267
9 SASI_Mm02_00346217 predicted 606
10 SASI_Mm01_00123189 predicted 1430
11 SASI_Mm01_00123184 predicted 707
12 SASI_Mm01_00123186 predicted 1744
13 SASI_Mm01_00123190 predicted 2227
14 SASI_Mm01_00123191 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175384
VALIDATED
CDCA2 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175384.3-2570s1c1
Sequence:CCGGCGCTTCAGTGCATTGCACATTCTCGAGAATGTGCAATGCACTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175384.3-932s1c1
Sequence:CCGGCAGGCACTAACACTTGCAGTTCTCGAGAACTGCAAGTGTTAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175384.3-1212s1c1
Sequence:CCGGGCCAAGAGACATTGCATCGAACTCGAGTTCGATGCAATGTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175384.3-1981s1c1
Sequence:CCGGCAGAGTTCATACCTGGAACAACTCGAGTTGTTCCAGGTATGAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175384.3-502s1c1
Sequence:CCGGCTTCGTTCTGTGTTGAAGAAACTCGAGTTTCTTCAACACAGAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175384.3-501s1c1
Sequence:CCGGGCTTCGTTCTGTGTTGAAGAACTCGAGTTCTTCAACACAGAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175384.4-3347s1c1
Sequence:CCGGGGACCTTTAGAATGACTTATTCTCGAGAATAAGTCATTCTAAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175384
VALIDATED
CDCA2 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175384.3-2570s1c1
Sequence:CCGGCGCTTCAGTGCATTGCACATTCTCGAGAATGTGCAATGCACTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175384.3-932s1c1
Sequence:CCGGCAGGCACTAACACTTGCAGTTCTCGAGAACTGCAAGTGTTAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175384.3-1212s1c1
Sequence:CCGGGCCAAGAGACATTGCATCGAACTCGAGTTCGATGCAATGTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175384.3-1981s1c1
Sequence:CCGGCAGAGTTCATACCTGGAACAACTCGAGTTGTTCCAGGTATGAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175384.3-502s1c1
Sequence:CCGGCTTCGTTCTGTGTTGAAGAAACTCGAGTTTCTTCAACACAGAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175384.3-501s1c1
Sequence:CCGGGCTTCGTTCTGTGTTGAAGAACTCGAGTTCTTCAACACAGAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175384.4-3347s1c1
Sequence:CCGGGGACCTTTAGAATGACTTATTCTCGAGAATAAGTCATTCTAAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175384
VALIDATED
CDCA2 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175384.3-2570s1c1
Sequence:CCGGCGCTTCAGTGCATTGCACATTCTCGAGAATGTGCAATGCACTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175384.3-932s1c1
Sequence:CCGGCAGGCACTAACACTTGCAGTTCTCGAGAACTGCAAGTGTTAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175384.3-1212s1c1
Sequence:CCGGGCCAAGAGACATTGCATCGAACTCGAGTTCGATGCAATGTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175384.3-1981s1c1
Sequence:CCGGCAGAGTTCATACCTGGAACAACTCGAGTTGTTCCAGGTATGAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175384.3-502s1c1
Sequence:CCGGCTTCGTTCTGTGTTGAAGAAACTCGAGTTTCTTCAACACAGAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175384.3-501s1c1
Sequence:CCGGGCTTCGTTCTGTGTTGAAGAACTCGAGTTCTTCAACACAGAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175384.4-3347s1c1
Sequence:CCGGGGACCTTTAGAATGACTTATTCTCGAGAATAAGTCATTCTAAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152562
VALIDATED
CDCA2 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152562.2-652s1c1
Sequence:CCGGCCACAGTAACCGTAGAGCAATCTCGAGATTGCTCTACGGTTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152562.2-1875s1c1
Sequence:CCGGGCCGTTCTCAGTTCTCCTAATCTCGAGATTAGGAGAACTGAGAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152562.2-1681s1c1
Sequence:CCGGCGGAAGTGTTTGATGAATCTTCTCGAGAAGATTCATCAAACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152562.2-1876s1c1
Sequence:CCGGCCGTTCTCAGTTCTCCTAATACTCGAGTATTAGGAGAACTGAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152562.2-3113s1c1
Sequence:CCGGGCAAACCTTTCAGAGGAGAAACTCGAGTTTCTCCTCTGAAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-2985s21c1
Sequence:CCGGTATTCTGATGGTCGAAGTTTACTCGAGTAAACTTCGACCATCAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152562.2-2417s21c1
Sequence:CCGGTATGCATCAAGGCTATGATAACTCGAGTTATCATAGCCTTGATGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152562.2-3555s21c1
Sequence:CCGGACATTTCCTGCAGAGTCTGTGCTCGAGCACAGACTCTGCAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-1854s21c1
Sequence:CCGGGAACCACTTCAAGTATCATTTCTCGAGAAATGATACTTGAAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-1541s21c1
Sequence:CCGGTGGGACTCATCCGAGCTTAATCTCGAGATTAAGCTCGGATGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-2310s21c1
Sequence:CCGGAGACTGGGTTCAGGTTATTTCCTCGAGGAAATAACCTGAACCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152562.2-3571s21c1
Sequence:CCGGCTGTGGCAAGAGGGAAAGTAACTCGAGTTACTTTCCCTCTTGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152562
VALIDATED
CDCA2 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152562.2-652s1c1
Sequence:CCGGCCACAGTAACCGTAGAGCAATCTCGAGATTGCTCTACGGTTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152562.2-1875s1c1
Sequence:CCGGGCCGTTCTCAGTTCTCCTAATCTCGAGATTAGGAGAACTGAGAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152562.2-1681s1c1
Sequence:CCGGCGGAAGTGTTTGATGAATCTTCTCGAGAAGATTCATCAAACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152562.2-1876s1c1
Sequence:CCGGCCGTTCTCAGTTCTCCTAATACTCGAGTATTAGGAGAACTGAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152562.2-3113s1c1
Sequence:CCGGGCAAACCTTTCAGAGGAGAAACTCGAGTTTCTCCTCTGAAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-2985s21c1
Sequence:CCGGTATTCTGATGGTCGAAGTTTACTCGAGTAAACTTCGACCATCAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152562.2-2417s21c1
Sequence:CCGGTATGCATCAAGGCTATGATAACTCGAGTTATCATAGCCTTGATGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152562.2-3555s21c1
Sequence:CCGGACATTTCCTGCAGAGTCTGTGCTCGAGCACAGACTCTGCAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-1854s21c1
Sequence:CCGGGAACCACTTCAAGTATCATTTCTCGAGAAATGATACTTGAAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-1541s21c1
Sequence:CCGGTGGGACTCATCCGAGCTTAATCTCGAGATTAAGCTCGGATGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-2310s21c1
Sequence:CCGGAGACTGGGTTCAGGTTATTTCCTCGAGGAAATAACCTGAACCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152562.2-3571s21c1
Sequence:CCGGCTGTGGCAAGAGGGAAAGTAACTCGAGTTACTTTCCCTCTTGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152562
VALIDATED
CDCA2 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152562.2-652s1c1
Sequence:CCGGCCACAGTAACCGTAGAGCAATCTCGAGATTGCTCTACGGTTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152562.2-1875s1c1
Sequence:CCGGGCCGTTCTCAGTTCTCCTAATCTCGAGATTAGGAGAACTGAGAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152562.2-1681s1c1
Sequence:CCGGCGGAAGTGTTTGATGAATCTTCTCGAGAAGATTCATCAAACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152562.2-1876s1c1
Sequence:CCGGCCGTTCTCAGTTCTCCTAATACTCGAGTATTAGGAGAACTGAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152562.2-3113s1c1
Sequence:CCGGGCAAACCTTTCAGAGGAGAAACTCGAGTTTCTCCTCTGAAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-2985s21c1
Sequence:CCGGTATTCTGATGGTCGAAGTTTACTCGAGTAAACTTCGACCATCAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152562.2-2417s21c1
Sequence:CCGGTATGCATCAAGGCTATGATAACTCGAGTTATCATAGCCTTGATGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152562.2-3555s21c1
Sequence:CCGGACATTTCCTGCAGAGTCTGTGCTCGAGCACAGACTCTGCAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-1854s21c1
Sequence:CCGGGAACCACTTCAAGTATCATTTCTCGAGAAATGATACTTGAAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-1541s21c1
Sequence:CCGGTGGGACTCATCCGAGCTTAATCTCGAGATTAAGCTCGGATGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152562.2-2310s21c1
Sequence:CCGGAGACTGGGTTCAGGTTATTTCCTCGAGGAAATAACCTGAACCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152562.2-3571s21c1
Sequence:CCGGCTGTGGCAAGAGGGAAAGTAACTCGAGTTACTTTCCCTCTTGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks