EMAIL THIS PAGE TO A FRIEND

CDCA3

cell division cycle associated 3

53 Gene Product Result for
Synonyms: GRCC8 TOME-1
UniProtKB ID: Q99618, A8K5V6, D3DUS6
Gene ID:
Mouse(14793) cell division cycle associated 3
Rat(297594) cell division cycle associated 3
naked mole-rat(101719596) cell division cycle associated 3
domestic guinea pig(100725438) cell division cycle associated 3
sheep(101110222) cell division cycle associated 3
chicken(770517) cell division cycle associated 3
dog(611617) cell division cycle associated 3
cow(614434) cell division cycle associated 3
domestic cat(101085049) cell division cycle associated 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031299 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031299 Rosetta Predictions human pricing
NM_001007648 Rosetta Predictions rat pricing
NM_013538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358738 predicted 886
2 SASI_Hs02_00358739 predicted 877
3 SASI_Hs01_00037115 predicted 674
4 SASI_Hs02_00358740 predicted 702
5 SASI_Hs01_00037118 predicted 835
6 SASI_Hs01_00037120 predicted 761
7 SASI_Hs01_00037122 predicted 821
8 SASI_Hs02_00358741 predicted 824
9 SASI_Hs02_00358742 predicted 725
10 SASI_Hs02_00358743 predicted 758
11 SASI_Hs01_00037114 predicted 654
12 SASI_Hs01_00037116 predicted 445
13 SASI_Hs01_00037117 predicted 510
14 SASI_Hs01_00037119 predicted 268
15 SASI_Hs01_00037121 predicted 365
16 SASI_Hs01_00037123 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198761 predicted 959
2 SASI_Rn01_00086918 predicted 735
3 SASI_Rn02_00198762 predicted 821
4 SASI_Rn02_00198763 predicted 667
5 SASI_Rn02_00198764 predicted 1097
6 SASI_Rn02_00198765 predicted 1233
7 SASI_Rn02_00198766 predicted 1244
8 SASI_Rn02_00198767 predicted 977
9 SASI_Rn02_00198768 predicted 955
10 SASI_Rn02_00198769 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151831 predicted 522
2 SASI_Mm01_00151832 predicted 430
3 SASI_Mm01_00151833 predicted 730
4 SASI_Mm01_00151834 predicted 929
5 SASI_Mm01_00151835 predicted 490
6 SASI_Mm01_00151836 predicted 1165
7 SASI_Mm01_00151839 predicted 1112
8 SASI_Mm01_00151840 predicted 215
9 SASI_Mm02_00322238 predicted 807
10 SASI_Mm02_00322239 predicted 738
11 SASI_Mm01_00151837 predicted 974
12 SASI_Mm01_00151838 predicted 1121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013538
VALIDATED
CDCA3 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-586s21c1
Sequence:CCGGGCCAAACAATCCGCAGAAACTCTCGAGAGTTTCTGCGGATTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-393s21c1
Sequence:CCGGGAAAGAGCTGAGCGAAGTATTCTCGAGAATACTTCGCTCAGCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-554s21c1
Sequence:CCGGTCGATCCCAAACAGGTGTTTACTCGAGTAAACACCTGTTTGGGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-756s21c1
Sequence:CCGGCTTGACACTACGACAGGGTAACTCGAGTTACCCTGTCGTAGTGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013538.3-697s1c1
Sequence:CCGGCTTGACACTACGACAGGGTAACTCGAGTTACCCTGTCGTAGTGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013538.3-1038s1c1
Sequence:CCGGCCGGGTCTTGTGTGTATAGAACTCGAGTTCTATACACACAAGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013538.3-527s1c1
Sequence:CCGGGCCAAACAATCCGCAGAAACTCTCGAGAGTTTCTGCGGATTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013538.3-1039s1c1
Sequence:CCGGCGGGTCTTGTGTGTATAGAATCTCGAGATTCTATACACACAAGACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013538.3-334s1c1
Sequence:CCGGGAAAGAGCTGAGCGAAGTATTCTCGAGAATACTTCGCTCAGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013538
VALIDATED
CDCA3 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-586s21c1
Sequence:CCGGGCCAAACAATCCGCAGAAACTCTCGAGAGTTTCTGCGGATTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-393s21c1
Sequence:CCGGGAAAGAGCTGAGCGAAGTATTCTCGAGAATACTTCGCTCAGCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-554s21c1
Sequence:CCGGTCGATCCCAAACAGGTGTTTACTCGAGTAAACACCTGTTTGGGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-756s21c1
Sequence:CCGGCTTGACACTACGACAGGGTAACTCGAGTTACCCTGTCGTAGTGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013538.3-697s1c1
Sequence:CCGGCTTGACACTACGACAGGGTAACTCGAGTTACCCTGTCGTAGTGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013538.3-1038s1c1
Sequence:CCGGCCGGGTCTTGTGTGTATAGAACTCGAGTTCTATACACACAAGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013538.3-527s1c1
Sequence:CCGGGCCAAACAATCCGCAGAAACTCTCGAGAGTTTCTGCGGATTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013538.3-1039s1c1
Sequence:CCGGCGGGTCTTGTGTGTATAGAATCTCGAGATTCTATACACACAAGACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013538.3-334s1c1
Sequence:CCGGGAAAGAGCTGAGCGAAGTATTCTCGAGAATACTTCGCTCAGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013538
VALIDATED
CDCA3 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-586s21c1
Sequence:CCGGGCCAAACAATCCGCAGAAACTCTCGAGAGTTTCTGCGGATTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-393s21c1
Sequence:CCGGGAAAGAGCTGAGCGAAGTATTCTCGAGAATACTTCGCTCAGCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-554s21c1
Sequence:CCGGTCGATCCCAAACAGGTGTTTACTCGAGTAAACACCTGTTTGGGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013538.5-756s21c1
Sequence:CCGGCTTGACACTACGACAGGGTAACTCGAGTTACCCTGTCGTAGTGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013538.3-697s1c1
Sequence:CCGGCTTGACACTACGACAGGGTAACTCGAGTTACCCTGTCGTAGTGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013538.3-1038s1c1
Sequence:CCGGCCGGGTCTTGTGTGTATAGAACTCGAGTTCTATACACACAAGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013538.3-527s1c1
Sequence:CCGGGCCAAACAATCCGCAGAAACTCTCGAGAGTTTCTGCGGATTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013538.3-1039s1c1
Sequence:CCGGCGGGTCTTGTGTGTATAGAATCTCGAGATTCTATACACACAAGACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013538.3-334s1c1
Sequence:CCGGGAAAGAGCTGAGCGAAGTATTCTCGAGAATACTTCGCTCAGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031299
VALIDATED
CDCA3 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-285s21c1
Sequence:CCGGGAGCAACTGGAGGGTCTTAAACTCGAGTTTAAGACCCTCCAGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031299.4-816s21c1
Sequence:CCGGGAACTAAAGGAAGGAGCCATTCTCGAGAATGGCTCCTTCCTTTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-398s21c1
Sequence:CCGGGAAACAGCTGAGTGAAGTATTCTCGAGAATACTTCACTCAGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-833s21c1
Sequence:CCGGCATTCTTGGAACTGGACGACTCTCGAGAGTCGTCCAGTTCCAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-515s21c1
Sequence:CCGGGTTATCTGTTGAGGAACAGATCTCGAGATCTGTTCCTCAACAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-254s1c1
Sequence:CCGGGAGCAACTGGAGGGTCTTAAACTCGAGTTTAAGACCCTCCAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-367s1c1
Sequence:CCGGGAAACAGCTGAGTGAAGTATTCTCGAGAATACTTCACTCAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-484s1c1
Sequence:CCGGGTTATCTGTTGAGGAACAGATCTCGAGATCTGTTCCTCAACAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031299.3-788s1c1
Sequence:CCGGCTAAAGGAAGGAGCCATTCTTCTCGAGAAGAATGGCTCCTTCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031299.3-980s1c1
Sequence:CCGGGATACTGAGGAATGGCTTGTTCTCGAGAACAAGCCATTCCTCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-785s1c1
Sequence:CCGGGAACTAAAGGAAGGAGCCATTCTCGAGAATGGCTCCTTCCTTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031299.3-627s1c1
Sequence:CCGGCTCCCAGATCTTCAGGTTCTACTCGAGTAGAACCTGAAGATCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-802s1c1
Sequence:CCGGCATTCTTGGAACTGGACGACTCTCGAGAGTCGTCCAGTTCCAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031299
VALIDATED
CDCA3 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-285s21c1
Sequence:CCGGGAGCAACTGGAGGGTCTTAAACTCGAGTTTAAGACCCTCCAGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031299.4-816s21c1
Sequence:CCGGGAACTAAAGGAAGGAGCCATTCTCGAGAATGGCTCCTTCCTTTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-398s21c1
Sequence:CCGGGAAACAGCTGAGTGAAGTATTCTCGAGAATACTTCACTCAGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-833s21c1
Sequence:CCGGCATTCTTGGAACTGGACGACTCTCGAGAGTCGTCCAGTTCCAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-515s21c1
Sequence:CCGGGTTATCTGTTGAGGAACAGATCTCGAGATCTGTTCCTCAACAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-254s1c1
Sequence:CCGGGAGCAACTGGAGGGTCTTAAACTCGAGTTTAAGACCCTCCAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-367s1c1
Sequence:CCGGGAAACAGCTGAGTGAAGTATTCTCGAGAATACTTCACTCAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-484s1c1
Sequence:CCGGGTTATCTGTTGAGGAACAGATCTCGAGATCTGTTCCTCAACAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031299.3-788s1c1
Sequence:CCGGCTAAAGGAAGGAGCCATTCTTCTCGAGAAGAATGGCTCCTTCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031299.3-980s1c1
Sequence:CCGGGATACTGAGGAATGGCTTGTTCTCGAGAACAAGCCATTCCTCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-785s1c1
Sequence:CCGGGAACTAAAGGAAGGAGCCATTCTCGAGAATGGCTCCTTCCTTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031299.3-627s1c1
Sequence:CCGGCTCCCAGATCTTCAGGTTCTACTCGAGTAGAACCTGAAGATCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-802s1c1
Sequence:CCGGCATTCTTGGAACTGGACGACTCTCGAGAGTCGTCCAGTTCCAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031299
VALIDATED
CDCA3 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-285s21c1
Sequence:CCGGGAGCAACTGGAGGGTCTTAAACTCGAGTTTAAGACCCTCCAGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031299.4-816s21c1
Sequence:CCGGGAACTAAAGGAAGGAGCCATTCTCGAGAATGGCTCCTTCCTTTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-398s21c1
Sequence:CCGGGAAACAGCTGAGTGAAGTATTCTCGAGAATACTTCACTCAGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-833s21c1
Sequence:CCGGCATTCTTGGAACTGGACGACTCTCGAGAGTCGTCCAGTTCCAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_031299.4-515s21c1
Sequence:CCGGGTTATCTGTTGAGGAACAGATCTCGAGATCTGTTCCTCAACAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-254s1c1
Sequence:CCGGGAGCAACTGGAGGGTCTTAAACTCGAGTTTAAGACCCTCCAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-367s1c1
Sequence:CCGGGAAACAGCTGAGTGAAGTATTCTCGAGAATACTTCACTCAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-484s1c1
Sequence:CCGGGTTATCTGTTGAGGAACAGATCTCGAGATCTGTTCCTCAACAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031299.3-788s1c1
Sequence:CCGGCTAAAGGAAGGAGCCATTCTTCTCGAGAAGAATGGCTCCTTCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031299.3-980s1c1
Sequence:CCGGGATACTGAGGAATGGCTTGTTCTCGAGAACAAGCCATTCCTCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-785s1c1
Sequence:CCGGGAACTAAAGGAAGGAGCCATTCTCGAGAATGGCTCCTTCCTTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031299.3-627s1c1
Sequence:CCGGCTCCCAGATCTTCAGGTTCTACTCGAGTAGAACCTGAAGATCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_031299.3-802s1c1
Sequence:CCGGCATTCTTGGAACTGGACGACTCTCGAGAGTCGTCCAGTTCCAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks