EMAIL THIS PAGE TO A FRIEND

CDCA4

cell division cycle associated 4

117 Gene Product Result for
Synonyms: HEPP SEI-3/HEPP
UniProtKB ID: Q9BXL8, Q8TB18, Q9NWK7
Gene ID:
Human(55038) Summary: This gene encodes a protein that belongs to the E2F family of transcription factors. This protein regulates E2F-dependent transcriptional activation and cell proliferation, mainly through the E2F/retinoblastoma protein pathway. It also functions in the regulaton of JUN oncogene expression. This protein shows distinctive nuclear-mitotic apparatus distribution, it is involved in spindle organization from prometaphase, and may also play a role as a midzone factor involved in chromosome segregation or cytokinesis. Two alternatively spliced transcript variants encoding the same protein have been noted for this gene. Two pseudogenes have also been identified on chromosome 1. [provided by RefSeq, Sep 2008]
Mouse(71963) cell division cycle associated 4
Rat(500727) cell division cycle associated 4
chicken(423500) cell division cycle associated 4
cow(527837) cell division cycle associated 4
domestic cat(101100819) cell division cycle associated 4
dog(612703) cell division cycle associated 4
sheep(101105444) cell division cycle associated 4
domestic guinea pig(100715479) cell division cycle associated 4
naked mole-rat(101697404) cell division cycle associated 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145701 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017955 Rosetta Predictions human pricing
NM_145701 Rosetta Predictions human pricing
NM_001037214 Rosetta Predictions rat pricing
NM_028023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190826 predicted 642
2 SASI_Hs01_00190827 predicted 522
3 SASI_Hs01_00190828 predicted 597
4 SASI_Hs01_00190829 predicted 620
5 SASI_Hs01_00190830 predicted 597
6 SASI_Hs01_00190831 predicted 632
7 SASI_Hs01_00190832 predicted 595
8 SASI_Hs01_00190833 predicted 698
9 SASI_Hs02_00350987 predicted 539
10 SASI_Hs02_00350988 predicted 625
11 SASI_Hs01_00190834 predicted 621
12 SASI_Hs01_00190835 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134609 predicted 635
2 SASI_Hs01_00134610 predicted 526
3 SASI_Hs01_00134611 predicted 597
4 SASI_Hs01_00134612 predicted 628
5 SASI_Hs01_00134613 predicted 597
6 SASI_Hs01_00134614 predicted 628
7 SASI_Hs01_00134615 predicted 600
8 SASI_Hs01_00134616 predicted 691
9 SASI_Hs02_00365309 predicted 536
10 SASI_Hs02_00365310 predicted 623
11 SASI_Hs01_00134617 predicted 622
12 SASI_Hs01_00134618 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098058 predicted 536
2 SASI_Rn01_00098059 predicted 383
3 SASI_Rn01_00098060 predicted 892
4 SASI_Rn02_00204334 predicted 551
5 SASI_Rn01_00098061 predicted 1120
6 SASI_Rn01_00098062 predicted 816
7 SASI_Rn01_00098063 predicted 799
8 SASI_Rn01_00098064 predicted 853
9 SASI_Rn01_00098066 predicted 305
10 SASI_Rn01_00098067 predicted 981
11 SASI_Rn01_00098065 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094610 predicted 1135
2 SASI_Mm01_00094611 predicted 1076
3 SASI_Mm01_00094612 predicted 1061
4 SASI_Mm01_00094615 predicted 1111
5 SASI_Mm02_00333160 predicted 658
6 SASI_Mm01_00094607 predicted 1047
7 SASI_Mm01_00094608 predicted 566
8 SASI_Mm01_00094609 predicted 885
9 SASI_Mm01_00094613 predicted 673
10 SASI_Mm01_00094614 predicted 1008
11 SASI_Mm01_00094616 predicted 791
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028023
VALIDATED
CDCA4 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028023.3-1082s1c1
Sequence:CCGGGATGTGGACAGCTCCTACTATCTCGAGATAGTAGGAGCTGTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028023.3-1879s1c1
Sequence:CCGGGCCACTGAAAGCTAAGGTCTTCTCGAGAAGACCTTAGCTTTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028023.3-1590s1c1
Sequence:CCGGGCTGCTACATTAGAAACATTTCTCGAGAAATGTTTCTAATGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028023.3-1027s1c1
Sequence:CCGGGATATTTGAGACCCTGGAGAACTCGAGTTCTCCAGGGTCTCAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-681s21c1
Sequence:CCGGACATGCTAGTGGAGCCCAATCCTCGAGGATTGGGCTCCACTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028023.3-830s21c1
Sequence:CCGGGAGATCCTGTGTCGTACAGTGCTCGAGCACTGTACGACACAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028023.3-1879s21c1
Sequence:CCGGGCCACTGAAAGCTAAGGTCTTCTCGAGAAGACCTTAGCTTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028023.3-794s21c1
Sequence:CCGGGTAGATCGGGCACCAGTTGAACTCGAGTTCAACTGGTGCCCGATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-1227s21c1
Sequence:CCGGTGGACCATGTGGTAGAGATTCCTCGAGGAATCTCTACCACATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-1104s21c1
Sequence:CCGGACCTGGACACAGTGCTAACAGCTCGAGCTGTTAGCACTGTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-606s21c1
Sequence:CCGGTTGGCACTGTCCCTTCCTATACTCGAGTATAGGAAGGGACAGTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-1194s21c1
Sequence:CCGGCCAGTTCCACTTGCAAGTCTGCTCGAGCAGACTTGCAAGTGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028023
VALIDATED
CDCA4 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028023.3-1082s1c1
Sequence:CCGGGATGTGGACAGCTCCTACTATCTCGAGATAGTAGGAGCTGTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028023.3-1879s1c1
Sequence:CCGGGCCACTGAAAGCTAAGGTCTTCTCGAGAAGACCTTAGCTTTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028023.3-1590s1c1
Sequence:CCGGGCTGCTACATTAGAAACATTTCTCGAGAAATGTTTCTAATGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028023.3-1027s1c1
Sequence:CCGGGATATTTGAGACCCTGGAGAACTCGAGTTCTCCAGGGTCTCAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-681s21c1
Sequence:CCGGACATGCTAGTGGAGCCCAATCCTCGAGGATTGGGCTCCACTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028023.3-830s21c1
Sequence:CCGGGAGATCCTGTGTCGTACAGTGCTCGAGCACTGTACGACACAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028023.3-1879s21c1
Sequence:CCGGGCCACTGAAAGCTAAGGTCTTCTCGAGAAGACCTTAGCTTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028023.3-794s21c1
Sequence:CCGGGTAGATCGGGCACCAGTTGAACTCGAGTTCAACTGGTGCCCGATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-1227s21c1
Sequence:CCGGTGGACCATGTGGTAGAGATTCCTCGAGGAATCTCTACCACATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-1104s21c1
Sequence:CCGGACCTGGACACAGTGCTAACAGCTCGAGCTGTTAGCACTGTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-606s21c1
Sequence:CCGGTTGGCACTGTCCCTTCCTATACTCGAGTATAGGAAGGGACAGTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-1194s21c1
Sequence:CCGGCCAGTTCCACTTGCAAGTCTGCTCGAGCAGACTTGCAAGTGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028023
VALIDATED
CDCA4 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028023.3-1082s1c1
Sequence:CCGGGATGTGGACAGCTCCTACTATCTCGAGATAGTAGGAGCTGTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028023.3-1879s1c1
Sequence:CCGGGCCACTGAAAGCTAAGGTCTTCTCGAGAAGACCTTAGCTTTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028023.3-1590s1c1
Sequence:CCGGGCTGCTACATTAGAAACATTTCTCGAGAAATGTTTCTAATGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028023.3-1027s1c1
Sequence:CCGGGATATTTGAGACCCTGGAGAACTCGAGTTCTCCAGGGTCTCAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-681s21c1
Sequence:CCGGACATGCTAGTGGAGCCCAATCCTCGAGGATTGGGCTCCACTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028023.3-830s21c1
Sequence:CCGGGAGATCCTGTGTCGTACAGTGCTCGAGCACTGTACGACACAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028023.3-1879s21c1
Sequence:CCGGGCCACTGAAAGCTAAGGTCTTCTCGAGAAGACCTTAGCTTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028023.3-794s21c1
Sequence:CCGGGTAGATCGGGCACCAGTTGAACTCGAGTTCAACTGGTGCCCGATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-1227s21c1
Sequence:CCGGTGGACCATGTGGTAGAGATTCCTCGAGGAATCTCTACCACATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-1104s21c1
Sequence:CCGGACCTGGACACAGTGCTAACAGCTCGAGCTGTTAGCACTGTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-606s21c1
Sequence:CCGGTTGGCACTGTCCCTTCCTATACTCGAGTATAGGAAGGGACAGTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028023.3-1194s21c1
Sequence:CCGGCCAGTTCCACTTGCAAGTCTGCTCGAGCAGACTTGCAAGTGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145701
VALIDATED
CDCA4 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145701.1-1071s1c1
Sequence:CCGGCCTAGACCTAAGAGTAAATTACTCGAGTAATTTACTCTTAGGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145701.1-531s1c1
Sequence:CCGGAGGGTCCAGTTTCTGACCTTTCTCGAGAAAGGTCAGAAACTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145701.1-640s1c1
Sequence:CCGGCAAGTCACTTGATCAGATATTCTCGAGAATATCTGATCAAGTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145701.1-284s1c1
Sequence:CCGGTCTCTGGTGAAGTTGCAGCTTCTCGAGAAGCTGCAACTTCACCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145701.1-231s1c1
Sequence:CCGGGCTTGAAGACAGTGTCCTCATCTCGAGATGAGGACACTGTCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-573s21c1
Sequence:CCGGCAAGTCACTTGATCAGATATTCTCGAGAATATCTGATCAAGTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145701.2-1063s21c1
Sequence:CCGGATTGAAGACAAAGGTCAAATACTCGAGTATTTGACCTTTGTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-164s21c1
Sequence:CCGGGCTTGAAGACAGTGTCCTCATCTCGAGATGAGGACACTGTCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-658s21c1
Sequence:CCGGTACTACGACCTGGACACAGTACTCGAGTACTGTGTCCAGGTCGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-123s21c1
Sequence:CCGGATGTGTTGGCCACGAGGAAGACTCGAGTCTTCCTCGTGGCCAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145701
VALIDATED
CDCA4 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145701.1-1071s1c1
Sequence:CCGGCCTAGACCTAAGAGTAAATTACTCGAGTAATTTACTCTTAGGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145701.1-531s1c1
Sequence:CCGGAGGGTCCAGTTTCTGACCTTTCTCGAGAAAGGTCAGAAACTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145701.1-640s1c1
Sequence:CCGGCAAGTCACTTGATCAGATATTCTCGAGAATATCTGATCAAGTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145701.1-284s1c1
Sequence:CCGGTCTCTGGTGAAGTTGCAGCTTCTCGAGAAGCTGCAACTTCACCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145701.1-231s1c1
Sequence:CCGGGCTTGAAGACAGTGTCCTCATCTCGAGATGAGGACACTGTCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-573s21c1
Sequence:CCGGCAAGTCACTTGATCAGATATTCTCGAGAATATCTGATCAAGTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145701.2-1063s21c1
Sequence:CCGGATTGAAGACAAAGGTCAAATACTCGAGTATTTGACCTTTGTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-164s21c1
Sequence:CCGGGCTTGAAGACAGTGTCCTCATCTCGAGATGAGGACACTGTCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-658s21c1
Sequence:CCGGTACTACGACCTGGACACAGTACTCGAGTACTGTGTCCAGGTCGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-123s21c1
Sequence:CCGGATGTGTTGGCCACGAGGAAGACTCGAGTCTTCCTCGTGGCCAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145701
VALIDATED
CDCA4 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145701.1-1071s1c1
Sequence:CCGGCCTAGACCTAAGAGTAAATTACTCGAGTAATTTACTCTTAGGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145701.1-531s1c1
Sequence:CCGGAGGGTCCAGTTTCTGACCTTTCTCGAGAAAGGTCAGAAACTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145701.1-640s1c1
Sequence:CCGGCAAGTCACTTGATCAGATATTCTCGAGAATATCTGATCAAGTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145701.1-284s1c1
Sequence:CCGGTCTCTGGTGAAGTTGCAGCTTCTCGAGAAGCTGCAACTTCACCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145701.1-231s1c1
Sequence:CCGGGCTTGAAGACAGTGTCCTCATCTCGAGATGAGGACACTGTCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-573s21c1
Sequence:CCGGCAAGTCACTTGATCAGATATTCTCGAGAATATCTGATCAAGTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145701.2-1063s21c1
Sequence:CCGGATTGAAGACAAAGGTCAAATACTCGAGTATTTGACCTTTGTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-164s21c1
Sequence:CCGGGCTTGAAGACAGTGTCCTCATCTCGAGATGAGGACACTGTCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-658s21c1
Sequence:CCGGTACTACGACCTGGACACAGTACTCGAGTACTGTGTCCAGGTCGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145701.2-123s21c1
Sequence:CCGGATGTGTTGGCCACGAGGAAGACTCGAGTCTTCCTCGTGGCCAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks