EMAIL THIS PAGE TO A FRIEND

CDCA5

cell division cycle associated 5

45 Gene Product Result for
Synonyms: SORORIN
UniProtKB ID: Q96FF9, A8K625
Gene ID:
Mouse(67849) cell division cycle associated 5
Rat(684771) cell division cycle associated 5
naked mole-rat(101701382) cell division cycle associated 5
domestic guinea pig(100724921) cell division cycle associated 5
Zebrafish(559398) cell division cycle associated 5
domestic cat(101083033) cell division cycle associated 5
cow(613318) cell division cycle associated 5
dog(612071) cell division cycle associated 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080668 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080668 Rosetta Predictions human pricing
NM_001115042 Rosetta Predictions rat pricing
NM_026410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203851 predicted 567
2 SASI_Hs01_00203852 predicted 871
3 SASI_Hs01_00203853 predicted 1031
4 SASI_Hs01_00203854 predicted 341
5 SASI_Hs01_00203855 predicted 798
6 SASI_Hs01_00203856 predicted 894
7 SASI_Hs01_00203857 predicted 711
8 SASI_Hs01_00203858 predicted 1129
9 SASI_Hs01_00203859 predicted 1055
10 SASI_Hs01_00203860 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252593 predicted 750
2 SASI_Rn02_00252594 predicted 641
3 SASI_Rn02_00252595 predicted 786
4 SASI_Rn02_00252596 predicted 1031
5 SASI_Rn02_00252597 predicted 871
6 SASI_Rn02_00252598 predicted 1057
7 SASI_Rn02_00252599 predicted 970
8 SASI_Rn02_00252600 predicted 917
9 SASI_Rn02_00252601 predicted 1114
10 SASI_Rn02_00252602 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091921 predicted 247
2 SASI_Mm01_00091922 predicted 828
3 SASI_Mm01_00091923 predicted 420
4 SASI_Mm01_00091924 predicted 752
5 SASI_Mm01_00091925 predicted 1058
6 SASI_Mm01_00091926 predicted 352
7 SASI_Mm01_00091927 predicted 834
8 SASI_Mm01_00091928 predicted 983
9 SASI_Mm01_00091929 predicted 804
10 SASI_Mm01_00091930 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026410
VALIDATED
CDCA5 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026410.3-865s21c1
Sequence:CCGGGAACTGGGATGCCCGTCATTACTCGAGTAATGACGGGCATCCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-603s21c1
Sequence:CCGGTGTCGTGTGTTCAAAGTTAATCTCGAGATTAACTTTGAACACACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-140s21c1
Sequence:CCGGCGAAGTCGTCCAAGCGGAAATCTCGAGATTTCCGCTTGGACGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-764s21c1
Sequence:CCGGAGGTTCCTGAAATCCTGAAATCTCGAGATTTCAGGATTTCAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026410.3-739s1c1
Sequence:CCGGGTTGTGAAAGAGAAACGAAAGCTCGAGCTTTCGTTTCTCTTTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-115s21c1
Sequence:CCGGCCCAGGACTTCACTTACTAAGCTCGAGCTTAGTAAGTGAAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026410.1-668s1c1
Sequence:CCGGCGAAGGACTTGGTTCCAGATACTCGAGTATCTGGAACCAAGTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026410
VALIDATED
CDCA5 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026410.3-865s21c1
Sequence:CCGGGAACTGGGATGCCCGTCATTACTCGAGTAATGACGGGCATCCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-603s21c1
Sequence:CCGGTGTCGTGTGTTCAAAGTTAATCTCGAGATTAACTTTGAACACACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-140s21c1
Sequence:CCGGCGAAGTCGTCCAAGCGGAAATCTCGAGATTTCCGCTTGGACGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-764s21c1
Sequence:CCGGAGGTTCCTGAAATCCTGAAATCTCGAGATTTCAGGATTTCAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026410.3-739s1c1
Sequence:CCGGGTTGTGAAAGAGAAACGAAAGCTCGAGCTTTCGTTTCTCTTTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-115s21c1
Sequence:CCGGCCCAGGACTTCACTTACTAAGCTCGAGCTTAGTAAGTGAAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026410.1-668s1c1
Sequence:CCGGCGAAGGACTTGGTTCCAGATACTCGAGTATCTGGAACCAAGTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026410
VALIDATED
CDCA5 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026410.3-865s21c1
Sequence:CCGGGAACTGGGATGCCCGTCATTACTCGAGTAATGACGGGCATCCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-603s21c1
Sequence:CCGGTGTCGTGTGTTCAAAGTTAATCTCGAGATTAACTTTGAACACACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-140s21c1
Sequence:CCGGCGAAGTCGTCCAAGCGGAAATCTCGAGATTTCCGCTTGGACGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-764s21c1
Sequence:CCGGAGGTTCCTGAAATCCTGAAATCTCGAGATTTCAGGATTTCAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026410.3-739s1c1
Sequence:CCGGGTTGTGAAAGAGAAACGAAAGCTCGAGCTTTCGTTTCTCTTTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026410.3-115s21c1
Sequence:CCGGCCCAGGACTTCACTTACTAAGCTCGAGCTTAGTAAGTGAAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026410.1-668s1c1
Sequence:CCGGCGAAGGACTTGGTTCCAGATACTCGAGTATCTGGAACCAAGTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080668
CDCA5 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080668.2-470s1c1
Sequence:CCGGGCCAGAGACTTGGAAATGTCTCTCGAGAGACATTTCCAAGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080668.2-709s1c1
Sequence:CCGGCGAGAAACAGAAACGTAAGAACTCGAGTTCTTACGTTTCTGTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080668.2-708s1c1
Sequence:CCGGCCGAGAAACAGAAACGTAAGACTCGAGTCTTACGTTTCTGTTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080668.2-1085s1c1
Sequence:CCGGCCAAAGTACCATAGCCAGTTTCTCGAGAAACTGGCTATGGTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080668.2-359s1c1
Sequence:CCGGGAGCTTACTAAGGAGGACCTTCTCGAGAAGGTCCTCCTTAGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080668.2-806s1c1
Sequence:CCGGGAGCAGTTTGATCTCCTGGTTCTCGAGAACCAGGAGATCAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080668.2-1292s1c1
Sequence:CCGGCCCACCTGTGTAAAGAGGTTTCTCGAGAAACCTCTTTACACAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080668.2-797s1c1
Sequence:CCGGGAAGCTGCTGAGCAGTTTGATCTCGAGATCAAACTGCTCAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080668
CDCA5 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080668.2-470s1c1
Sequence:CCGGGCCAGAGACTTGGAAATGTCTCTCGAGAGACATTTCCAAGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080668.2-709s1c1
Sequence:CCGGCGAGAAACAGAAACGTAAGAACTCGAGTTCTTACGTTTCTGTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080668.2-708s1c1
Sequence:CCGGCCGAGAAACAGAAACGTAAGACTCGAGTCTTACGTTTCTGTTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080668.2-1085s1c1
Sequence:CCGGCCAAAGTACCATAGCCAGTTTCTCGAGAAACTGGCTATGGTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080668.2-359s1c1
Sequence:CCGGGAGCTTACTAAGGAGGACCTTCTCGAGAAGGTCCTCCTTAGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080668.2-806s1c1
Sequence:CCGGGAGCAGTTTGATCTCCTGGTTCTCGAGAACCAGGAGATCAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080668.2-1292s1c1
Sequence:CCGGCCCACCTGTGTAAAGAGGTTTCTCGAGAAACCTCTTTACACAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080668.2-797s1c1
Sequence:CCGGGAAGCTGCTGAGCAGTTTGATCTCGAGATCAAACTGCTCAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080668
CDCA5 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080668.2-470s1c1
Sequence:CCGGGCCAGAGACTTGGAAATGTCTCTCGAGAGACATTTCCAAGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080668.2-709s1c1
Sequence:CCGGCGAGAAACAGAAACGTAAGAACTCGAGTTCTTACGTTTCTGTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080668.2-708s1c1
Sequence:CCGGCCGAGAAACAGAAACGTAAGACTCGAGTCTTACGTTTCTGTTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080668.2-1085s1c1
Sequence:CCGGCCAAAGTACCATAGCCAGTTTCTCGAGAAACTGGCTATGGTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080668.2-359s1c1
Sequence:CCGGGAGCTTACTAAGGAGGACCTTCTCGAGAAGGTCCTCCTTAGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080668.2-806s1c1
Sequence:CCGGGAGCAGTTTGATCTCCTGGTTCTCGAGAACCAGGAGATCAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080668.2-1292s1c1
Sequence:CCGGCCCACCTGTGTAAAGAGGTTTCTCGAGAAACCTCTTTACACAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080668.2-797s1c1
Sequence:CCGGGAAGCTGCTGAGCAGTTTGATCTCGAGATCAAACTGCTCAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks