EMAIL THIS PAGE TO A FRIEND

CDCA7

cell division cycle associated 7

73 Gene Product Result for
Synonyms: JPO1
Gene ID:
Human(83879) Summary: This gene was identified as a c-Myc responsive gene, and behaves as a direct c-Myc target gene. Overexpression of this gene is found to enhance the transformation of lymphoblastoid cells, and it complements a transformation-defective Myc Box II mutant, suggesting its involvement in c-Myc-mediated cell transformation. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(66953) cell division cycle associated 7
Rat(311742) cell division cycle associated 7
chicken(425630) cell division cycle associated 7
cow(614893) cell division cycle associated 7
Horse(100064197) cell division cycle associated 7
domestic cat(101094441) cell division cycle associated 7
dog(488403) cell division cycle associated 7
chicken(776142) cell division cycle associated 7
domestic guinea pig(100730407) cell division cycle associated 7
naked mole-rat(101708827) cell division cycle associated 7
sheep(101111162) cell division cycle associated 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031942 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031942 Rosetta Predictions human pricing
NM_145810 Rosetta Predictions human pricing
NM_001025693 Rosetta Predictions rat pricing
NM_025866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359089 predicted 1841
2 SASI_Hs02_00359090 predicted 1893
3 SASI_Hs02_00359091 predicted 1829
4 SASI_Hs02_00359092 predicted 1918
5 SASI_Hs02_00359093 predicted 1885
6 SASI_Hs01_00185011 predicted 1134
7 SASI_Hs02_00359094 predicted 1863
8 SASI_Hs02_00359095 predicted 1060
9 SASI_Hs02_00359096 predicted 1128
10 SASI_Hs02_00359097 predicted 919
11 SASI_Hs01_00185008 predicted 1651
12 SASI_Hs01_00185009 predicted 1552
13 SASI_Hs01_00185010 predicted 1505
14 SASI_Hs01_00185012 predicted 1605
15 SASI_Hs01_00185013 predicted 1188
16 SASI_Hs01_00185014 predicted 874
17 SASI_Hs01_00185015 predicted 757
18 SASI_Hs01_00185016 predicted 1581
19 SASI_Hs01_00185017 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212366 predicted 1406
2 SASI_Hs01_00212367 predicted 1309
3 SASI_Hs02_00365368 predicted 1409
4 SASI_Hs01_00212369 predicted 902
5 SASI_Hs01_00212370 predicted 1359
6 SASI_Hs02_00365369 predicted 1238
7 SASI_Hs01_00212371 predicted 952
8 SASI_Hs01_00212372 predicted 639
9 SASI_Hs02_00365370 predicted 1151
10 SASI_Hs01_00212374 predicted 1336
11 SASI_Hs01_00212368 predicted 1269
12 SASI_Hs01_00212373 predicted 524
13 SASI_Hs01_00212375 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044698 predicted 1180
2 SASI_Rn01_00044699 predicted 430
3 SASI_Rn01_00044700 predicted 730
4 SASI_Rn01_00044701 predicted 1251
5 SASI_Rn01_00044702 predicted 819
6 SASI_Rn01_00044703 predicted 1280
7 SASI_Rn01_00044704 predicted 744
8 SASI_Rn01_00044705 predicted 375
9 SASI_Rn01_00044706 predicted 521
10 SASI_Rn01_00044707 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329180 predicted 1460
2 SASI_Mm01_00105844 predicted 1614
3 SASI_Mm01_00105845 predicted 1504
4 SASI_Mm01_00105846 predicted 1321
5 SASI_Mm01_00105849 predicted 1134
6 SASI_Mm02_00329181 predicted 1257
7 SASI_Mm02_00329182 predicted 1387
8 SASI_Mm01_00105850 predicted 1604
9 SASI_Mm02_00329183 predicted 1256
10 SASI_Mm02_00329184 predicted 1696
11 SASI_Mm01_00105842 predicted 1350
12 SASI_Mm01_00105843 predicted 1299
13 SASI_Mm01_00105847 predicted 1703
14 SASI_Mm01_00105848 predicted 1396
15 SASI_Mm01_00105851 predicted 1388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031942
CDCA7 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031942.3-1515s1c1
Sequence:CCGGGCCTGCCTTCTACTTCTCAAACTCGAGTTTGAGAAGTAGAAGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031942.3-1089s1c1
Sequence:CCGGGCATATAATTCGCCCAGTGGACTCGAGTCCACTGGGCGAATTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031942.3-242s1c1
Sequence:CCGGCCTCTGATGACAGTTGTGACACTCGAGTGTCACAACTGTCATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031942.3-443s1c1
Sequence:CCGGCTAACGAACTGGCCGGTATTTCTCGAGAAATACCGGCCAGTTCGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031942.3-432s1c1
Sequence:CCGGGCCAGATGTCACTAACGAACTCTCGAGAGTTCGTTAGTGACATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031942.3-2056s1c1
Sequence:CCGGGCGCTTATGTTACAAGTTGTTCTCGAGAACAACTTGTAACATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031942.3-472s1c1
Sequence:CCGGGACTCTGACGATGAATCATTTCTCGAGAAATGATTCATCGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031942.4-1063s21c1
Sequence:CCGGCCGTGACCCTTCCGCATATAACTCGAGTTATATGCGGAAGGGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031942.4-369s21c1
Sequence:CCGGAGTGAGGTGCAAGATGTATTACTCGAGTAATACATCTTGCACCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031942.4-281s21c1
Sequence:CCGGACCTAAATTCAGGTCAGATATCTCGAGATATCTGACCTGAATTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031942.4-1596s21c1
Sequence:CCGGAGAAACTCCAATCAAGTTAATCTCGAGATTAACTTGATTGGAGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031942.4-1638s21c1
Sequence:CCGGGAGCATCACAGAAGGTATATTCTCGAGAATATACCTTCTGTGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031942
CDCA7 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031942.3-1515s1c1
Sequence:CCGGGCCTGCCTTCTACTTCTCAAACTCGAGTTTGAGAAGTAGAAGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031942.3-1089s1c1
Sequence:CCGGGCATATAATTCGCCCAGTGGACTCGAGTCCACTGGGCGAATTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031942.3-242s1c1
Sequence:CCGGCCTCTGATGACAGTTGTGACACTCGAGTGTCACAACTGTCATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031942.3-443s1c1
Sequence:CCGGCTAACGAACTGGCCGGTATTTCTCGAGAAATACCGGCCAGTTCGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031942.3-432s1c1
Sequence:CCGGGCCAGATGTCACTAACGAACTCTCGAGAGTTCGTTAGTGACATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031942.3-2056s1c1
Sequence:CCGGGCGCTTATGTTACAAGTTGTTCTCGAGAACAACTTGTAACATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031942.3-472s1c1
Sequence:CCGGGACTCTGACGATGAATCATTTCTCGAGAAATGATTCATCGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031942.4-1063s21c1
Sequence:CCGGCCGTGACCCTTCCGCATATAACTCGAGTTATATGCGGAAGGGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031942.4-369s21c1
Sequence:CCGGAGTGAGGTGCAAGATGTATTACTCGAGTAATACATCTTGCACCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031942.4-281s21c1
Sequence:CCGGACCTAAATTCAGGTCAGATATCTCGAGATATCTGACCTGAATTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031942.4-1596s21c1
Sequence:CCGGAGAAACTCCAATCAAGTTAATCTCGAGATTAACTTGATTGGAGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031942.4-1638s21c1
Sequence:CCGGGAGCATCACAGAAGGTATATTCTCGAGAATATACCTTCTGTGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031942
CDCA7 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031942.3-1515s1c1
Sequence:CCGGGCCTGCCTTCTACTTCTCAAACTCGAGTTTGAGAAGTAGAAGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031942.3-1089s1c1
Sequence:CCGGGCATATAATTCGCCCAGTGGACTCGAGTCCACTGGGCGAATTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031942.3-242s1c1
Sequence:CCGGCCTCTGATGACAGTTGTGACACTCGAGTGTCACAACTGTCATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031942.3-443s1c1
Sequence:CCGGCTAACGAACTGGCCGGTATTTCTCGAGAAATACCGGCCAGTTCGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031942.3-432s1c1
Sequence:CCGGGCCAGATGTCACTAACGAACTCTCGAGAGTTCGTTAGTGACATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031942.3-2056s1c1
Sequence:CCGGGCGCTTATGTTACAAGTTGTTCTCGAGAACAACTTGTAACATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031942.3-472s1c1
Sequence:CCGGGACTCTGACGATGAATCATTTCTCGAGAAATGATTCATCGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031942.4-1063s21c1
Sequence:CCGGCCGTGACCCTTCCGCATATAACTCGAGTTATATGCGGAAGGGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031942.4-369s21c1
Sequence:CCGGAGTGAGGTGCAAGATGTATTACTCGAGTAATACATCTTGCACCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031942.4-281s21c1
Sequence:CCGGACCTAAATTCAGGTCAGATATCTCGAGATATCTGACCTGAATTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031942.4-1596s21c1
Sequence:CCGGAGAAACTCCAATCAAGTTAATCTCGAGATTAACTTGATTGGAGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031942.4-1638s21c1
Sequence:CCGGGAGCATCACAGAAGGTATATTCTCGAGAATATACCTTCTGTGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025866
VALIDATED
CDCA7 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025866.1-463s1c1
Sequence:CCGGGAACAAAGCAATGCTTGCAAACTCGAGTTTGCAAGCATTGCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025866.1-1482s1c1
Sequence:CCGGGCTATCTTTAACTGGCAGCTTCTCGAGAAGCTGCCAGTTAAAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025866.1-101s1c1
Sequence:CCGGGCTCTCAAAGTAAAGAACTTACTCGAGTAAGTTCTTTACTTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025866.1-185s1c1
Sequence:CCGGGACAGCTTTGCTTCTGATAATCTCGAGATTATCAGAAGCAAAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-290s21c1
Sequence:CCGGTGAAGTTTCCGGCACGAAATACTCGAGTATTTCGTGCCGGAAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-513s21c1
Sequence:CCGGCTTGTTCTCTGGACGACATTCCTCGAGGAATGTCGTCCAGAGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025866.3-1481s21c1
Sequence:CCGGGCTATCTTTAACTGGCAGCTTCTCGAGAAGCTGCCAGTTAAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-801s21c1
Sequence:CCGGCATGACCCTTCCGCATATAATCTCGAGATTATATGCGGAAGGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-184s21c1
Sequence:CCGGGACAGCTTTGCTTCTGATAATCTCGAGATTATCAGAAGCAAAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025866
VALIDATED
CDCA7 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025866.1-463s1c1
Sequence:CCGGGAACAAAGCAATGCTTGCAAACTCGAGTTTGCAAGCATTGCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025866.1-1482s1c1
Sequence:CCGGGCTATCTTTAACTGGCAGCTTCTCGAGAAGCTGCCAGTTAAAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025866.1-101s1c1
Sequence:CCGGGCTCTCAAAGTAAAGAACTTACTCGAGTAAGTTCTTTACTTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025866.1-185s1c1
Sequence:CCGGGACAGCTTTGCTTCTGATAATCTCGAGATTATCAGAAGCAAAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-290s21c1
Sequence:CCGGTGAAGTTTCCGGCACGAAATACTCGAGTATTTCGTGCCGGAAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-513s21c1
Sequence:CCGGCTTGTTCTCTGGACGACATTCCTCGAGGAATGTCGTCCAGAGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025866.3-1481s21c1
Sequence:CCGGGCTATCTTTAACTGGCAGCTTCTCGAGAAGCTGCCAGTTAAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-801s21c1
Sequence:CCGGCATGACCCTTCCGCATATAATCTCGAGATTATATGCGGAAGGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-184s21c1
Sequence:CCGGGACAGCTTTGCTTCTGATAATCTCGAGATTATCAGAAGCAAAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025866
VALIDATED
CDCA7 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025866.1-463s1c1
Sequence:CCGGGAACAAAGCAATGCTTGCAAACTCGAGTTTGCAAGCATTGCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025866.1-1482s1c1
Sequence:CCGGGCTATCTTTAACTGGCAGCTTCTCGAGAAGCTGCCAGTTAAAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025866.1-101s1c1
Sequence:CCGGGCTCTCAAAGTAAAGAACTTACTCGAGTAAGTTCTTTACTTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025866.1-185s1c1
Sequence:CCGGGACAGCTTTGCTTCTGATAATCTCGAGATTATCAGAAGCAAAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-290s21c1
Sequence:CCGGTGAAGTTTCCGGCACGAAATACTCGAGTATTTCGTGCCGGAAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-513s21c1
Sequence:CCGGCTTGTTCTCTGGACGACATTCCTCGAGGAATGTCGTCCAGAGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025866.3-1481s21c1
Sequence:CCGGGCTATCTTTAACTGGCAGCTTCTCGAGAAGCTGCCAGTTAAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-801s21c1
Sequence:CCGGCATGACCCTTCCGCATATAATCTCGAGATTATATGCGGAAGGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025866.3-184s21c1
Sequence:CCGGGACAGCTTTGCTTCTGATAATCTCGAGATTATCAGAAGCAAAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks