EMAIL THIS PAGE TO A FRIEND

CDCA7L

cell division cycle associated 7-like

103 Gene Product Result for
Synonyms: JPO2 R1 RAM2
Gene ID:
Mouse(217946) cell division cycle associated 7 like
Rat(619566) cell division cycle associated 7 like
chicken(420608) cell division cycle associated 7-like
domestic cat(101095241) cell division cycle associated 7-like
cow(514631) cell division cycle associated 7-like
Horse(100067524) cell division cycle associated 7-like
dog(482347) cell division cycle associated 7-like
sheep(101108042) cell division cycle associated 7-like
naked mole-rat(101701569) cell division cycle associated 7-like
domestic guinea pig(100733412) cell division cycle associated 7-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018719 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062691 MISSION® esiRNA esiRNA human CDCA7L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127370 Rosetta Predictions human pricing
NM_001127371 Rosetta Predictions human pricing
NM_018719 Rosetta Predictions human pricing
NM_001034953 Rosetta Predictions rat pricing
NM_146040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329264 predicted 1137
2 SASI_Hs02_00329265 predicted 1712
3 SASI_Hs02_00329266 predicted 953
4 SASI_Hs02_00329267 predicted 913
5 SASI_Hs02_00329268 predicted 1674
6 SASI_Hs02_00329269 predicted 1404
7 SASI_Hs02_00329270 predicted 815
8 SASI_Hs02_00329271 predicted 751
9 SASI_Hs02_00329272 predicted 925
10 SASI_Hs02_00329273 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329274 predicted 992
2 SASI_Hs02_00329275 predicted 809
3 SASI_Hs02_00329276 predicted 769
4 SASI_Hs02_00329277 predicted 1262
5 SASI_Hs02_00329278 predicted 660
6 SASI_Hs02_00329279 predicted 852
7 SASI_Hs02_00329280 predicted 610
8 SASI_Hs02_00329281 predicted 541
9 SASI_Hs02_00329282 predicted 779
10 SASI_Hs02_00329283 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352261 predicted 1099
2 SASI_Hs02_00352262 predicted 1673
3 SASI_Hs01_00128569 predicted 927
4 SASI_Hs01_00128571 predicted 881
5 SASI_Hs02_00352263 predicted 1640
6 SASI_Hs02_00352264 predicted 1374
7 SASI_Hs01_00128572 predicted 778
8 SASI_Hs02_00352265 predicted 715
9 SASI_Hs01_00128573 predicted 891
10 SASI_Hs01_00128574 predicted 1014
11 SASI_Hs01_00128568 predicted 233
12 SASI_Hs01_00128570 predicted 653
13 SASI_Hs01_00128575 predicted 484
14 SASI_Hs01_00128576 predicted 1134
15 SASI_Hs01_00128577 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107301 predicted 799
2 SASI_Rn01_00107302 predicted 893
3 SASI_Rn02_00204147 predicted 1024
4 SASI_Rn01_00107303 predicted 688
5 SASI_Rn01_00107304 predicted 328
6 SASI_Rn01_00107305 predicted 1242
7 SASI_Rn01_00107306 predicted 203
8 SASI_Rn01_00107307 predicted 962
9 SASI_Rn01_00107308 predicted 630
10 SASI_Rn01_00107309 predicted 704
11 SASI_Rn01_00107310 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184546 predicted 531
2 SASI_Mm01_00184547 predicted 967
3 SASI_Mm01_00184548 predicted 971
4 SASI_Mm01_00184549 predicted 986
5 SASI_Mm01_00184550 predicted 1045
6 SASI_Mm01_00184551 predicted 1268
7 SASI_Mm01_00184552 predicted 559
8 SASI_Mm01_00184553 predicted 716
9 SASI_Mm02_00341644 predicted 901
10 SASI_Mm01_00184554 predicted 246
11 SASI_Mm01_00184545 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018719
VALIDATED
CDCA7L MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 7-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1814s21c1
Sequence:CCGGAGCTCCTGCACTTGATCTATCCTCGAGGATAGATCAAGTGCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018719.4-796s21c1
Sequence:CCGGGCCATGCTTGCCCAGTTATTGCTCGAGCAATAACTGGGCAAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-978s21c1
Sequence:CCGGCACTGTCTCAGCCGCTAAATTCTCGAGAATTTAGCGGCTGAGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-521s21c1
Sequence:CCGGGGTCTAGAAGAAGTAGTATTGCTCGAGCAATACTACTTCTTCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1059s21c1
Sequence:CCGGCAGACGACGTCACCGTATATCCTCGAGGATATACGGTGACGTCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1129s21c1
Sequence:CCGGGCCATAACTGTTCGAGATAAACTCGAGTTTATCTCGAACAGTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1905s21c1
Sequence:CCGGTAGACCACACACATCGTTTAACTCGAGTTAAACGATGTGTGTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-675s21c1
Sequence:CCGGCTGTAGACAGGTGATACAAAGCTCGAGCTTTGTATCACCTGTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-337s1c1
Sequence:CCGGGCAGGATTTACGCAGAGTGATCTCGAGATCACTCTGCGTAAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-771s1c1
Sequence:CCGGCCAGTTATTGGCGGAATTGAACTCGAGTTCAATTCCGCCAATAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018719.2-111s1c1
Sequence:CCGGCCCTAAAGAAGTGGCTGACATCTCGAGATGTCAGCCACTTCTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-592s1c1
Sequence:CCGGGCACGCTTACAGAATGAGAAACTCGAGTTTCTCATTCTGTAAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-1351s1c1
Sequence:CCGGGCCACAGGAATCCTCATTCATCTCGAGATGAATGAGGATTCCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018719
VALIDATED
CDCA7L MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 7-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1814s21c1
Sequence:CCGGAGCTCCTGCACTTGATCTATCCTCGAGGATAGATCAAGTGCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018719.4-796s21c1
Sequence:CCGGGCCATGCTTGCCCAGTTATTGCTCGAGCAATAACTGGGCAAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-978s21c1
Sequence:CCGGCACTGTCTCAGCCGCTAAATTCTCGAGAATTTAGCGGCTGAGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-521s21c1
Sequence:CCGGGGTCTAGAAGAAGTAGTATTGCTCGAGCAATACTACTTCTTCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1059s21c1
Sequence:CCGGCAGACGACGTCACCGTATATCCTCGAGGATATACGGTGACGTCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1129s21c1
Sequence:CCGGGCCATAACTGTTCGAGATAAACTCGAGTTTATCTCGAACAGTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1905s21c1
Sequence:CCGGTAGACCACACACATCGTTTAACTCGAGTTAAACGATGTGTGTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-675s21c1
Sequence:CCGGCTGTAGACAGGTGATACAAAGCTCGAGCTTTGTATCACCTGTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-337s1c1
Sequence:CCGGGCAGGATTTACGCAGAGTGATCTCGAGATCACTCTGCGTAAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-771s1c1
Sequence:CCGGCCAGTTATTGGCGGAATTGAACTCGAGTTCAATTCCGCCAATAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018719.2-111s1c1
Sequence:CCGGCCCTAAAGAAGTGGCTGACATCTCGAGATGTCAGCCACTTCTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-592s1c1
Sequence:CCGGGCACGCTTACAGAATGAGAAACTCGAGTTTCTCATTCTGTAAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-1351s1c1
Sequence:CCGGGCCACAGGAATCCTCATTCATCTCGAGATGAATGAGGATTCCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018719
VALIDATED
CDCA7L MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 7-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1814s21c1
Sequence:CCGGAGCTCCTGCACTTGATCTATCCTCGAGGATAGATCAAGTGCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018719.4-796s21c1
Sequence:CCGGGCCATGCTTGCCCAGTTATTGCTCGAGCAATAACTGGGCAAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-978s21c1
Sequence:CCGGCACTGTCTCAGCCGCTAAATTCTCGAGAATTTAGCGGCTGAGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-521s21c1
Sequence:CCGGGGTCTAGAAGAAGTAGTATTGCTCGAGCAATACTACTTCTTCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1059s21c1
Sequence:CCGGCAGACGACGTCACCGTATATCCTCGAGGATATACGGTGACGTCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1129s21c1
Sequence:CCGGGCCATAACTGTTCGAGATAAACTCGAGTTTATCTCGAACAGTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-1905s21c1
Sequence:CCGGTAGACCACACACATCGTTTAACTCGAGTTAAACGATGTGTGTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018719.4-675s21c1
Sequence:CCGGCTGTAGACAGGTGATACAAAGCTCGAGCTTTGTATCACCTGTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-337s1c1
Sequence:CCGGGCAGGATTTACGCAGAGTGATCTCGAGATCACTCTGCGTAAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-771s1c1
Sequence:CCGGCCAGTTATTGGCGGAATTGAACTCGAGTTCAATTCCGCCAATAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018719.2-111s1c1
Sequence:CCGGCCCTAAAGAAGTGGCTGACATCTCGAGATGTCAGCCACTTCTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-592s1c1
Sequence:CCGGGCACGCTTACAGAATGAGAAACTCGAGTTTCTCATTCTGTAAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018719.2-1351s1c1
Sequence:CCGGGCCACAGGAATCCTCATTCATCTCGAGATGAATGAGGATTCCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146040
VALIDATED
CDCA7L MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 7-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146040.1-1654s1c1
Sequence:CCGGGTTAATGCTCAGGTAAGTTATCTCGAGATAACTTACCTGAGCATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-910s1c1
Sequence:CCGGCAAGCTTACTGAAGAGCTTTACTCGAGTAAAGCTCTTCAGTAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-975s1c1
Sequence:CCGGCGTATAGACGTCATCGGATATCTCGAGATATCCGATGACGTCTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-725s1c1
Sequence:CCGGCAGTTGTTGGCGGAATTGAATCTCGAGATTCAATTCCGCCAACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-188s21c1
Sequence:CCGGTCAGAGAGCTGTGGTAGTTTGCTCGAGCAAACTACCACAGCTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-1773s21c1
Sequence:CCGGTAGCTCAAACCTGATAGTTTACTCGAGTAAACTATCAGGTTTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-1326s21c1
Sequence:CCGGTGGCCAAGTTCTACGGTTATGCTCGAGCATAACCGTAGAACTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-1046s21c1
Sequence:CCGGGCCATAACTGTGCGTGATAAACTCGAGTTTATCACGCACAGTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-975s21c1
Sequence:CCGGCGTATAGACGTCATCGGATATCTCGAGATATCCGATGACGTCTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-568s1c1
Sequence:CCGGGACGGATCTTAGAAGAAAGAACTCGAGTTCTTTCTTCTAAGATCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146040
VALIDATED
CDCA7L MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 7-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146040.1-1654s1c1
Sequence:CCGGGTTAATGCTCAGGTAAGTTATCTCGAGATAACTTACCTGAGCATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-910s1c1
Sequence:CCGGCAAGCTTACTGAAGAGCTTTACTCGAGTAAAGCTCTTCAGTAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-975s1c1
Sequence:CCGGCGTATAGACGTCATCGGATATCTCGAGATATCCGATGACGTCTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-725s1c1
Sequence:CCGGCAGTTGTTGGCGGAATTGAATCTCGAGATTCAATTCCGCCAACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-188s21c1
Sequence:CCGGTCAGAGAGCTGTGGTAGTTTGCTCGAGCAAACTACCACAGCTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-1773s21c1
Sequence:CCGGTAGCTCAAACCTGATAGTTTACTCGAGTAAACTATCAGGTTTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-1326s21c1
Sequence:CCGGTGGCCAAGTTCTACGGTTATGCTCGAGCATAACCGTAGAACTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-1046s21c1
Sequence:CCGGGCCATAACTGTGCGTGATAAACTCGAGTTTATCACGCACAGTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-975s21c1
Sequence:CCGGCGTATAGACGTCATCGGATATCTCGAGATATCCGATGACGTCTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-568s1c1
Sequence:CCGGGACGGATCTTAGAAGAAAGAACTCGAGTTCTTTCTTCTAAGATCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146040
VALIDATED
CDCA7L MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 7-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146040.1-1654s1c1
Sequence:CCGGGTTAATGCTCAGGTAAGTTATCTCGAGATAACTTACCTGAGCATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-910s1c1
Sequence:CCGGCAAGCTTACTGAAGAGCTTTACTCGAGTAAAGCTCTTCAGTAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-975s1c1
Sequence:CCGGCGTATAGACGTCATCGGATATCTCGAGATATCCGATGACGTCTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-725s1c1
Sequence:CCGGCAGTTGTTGGCGGAATTGAATCTCGAGATTCAATTCCGCCAACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-188s21c1
Sequence:CCGGTCAGAGAGCTGTGGTAGTTTGCTCGAGCAAACTACCACAGCTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-1773s21c1
Sequence:CCGGTAGCTCAAACCTGATAGTTTACTCGAGTAAACTATCAGGTTTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-1326s21c1
Sequence:CCGGTGGCCAAGTTCTACGGTTATGCTCGAGCATAACCGTAGAACTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-1046s21c1
Sequence:CCGGGCCATAACTGTGCGTGATAAACTCGAGTTTATCACGCACAGTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146040.1-975s21c1
Sequence:CCGGCGTATAGACGTCATCGGATATCTCGAGATATCCGATGACGTCTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146040.1-568s1c1
Sequence:CCGGGACGGATCTTAGAAGAAAGAACTCGAGTTCTTTCTTCTAAGATCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks