EMAIL THIS PAGE TO A FRIEND

CDCA8

cell division cycle associated 8

52 Gene Product Result for
Synonyms: BOR BOREALIN DasraB MESRGP
UniProtKB ID: Q53HL2, D3DPT4, Q53HN1, Q96AM3, Q9NVW5
Gene ID:
Human(55143) Summary: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16. [provided by RefSeq, Apr 2013]
Mouse(52276) cell division cycle associated 8
Rat(500545) cell division cycle associated 8
domestic guinea pig(100723828) cell division cycle associated 8
naked mole-rat(101700921) cell division cycle associated 8
sheep(101115324) cell division cycle associated 8
Zebrafish(492815) cell division cycle associated 8
cow(508022) cell division cycle associated 8
domestic cat(101091294) cell division cycle associated 8
dog(608164) cell division cycle associated 8
chicken(425084) cell division cycle associated 8
chicken(777014) Borealin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018101 Rosetta Predictions human pricing
NM_001025050 Rosetta Predictions rat pricing
NM_026560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153656 predicted 371
2 SASI_Hs01_00153657 predicted 1054
3 SASI_Hs01_00153658 predicted 546
4 SASI_Hs01_00153659 predicted 630
5 SASI_Hs01_00153660 predicted 317
6 SASI_Hs01_00153661 predicted 502
7 SASI_Hs01_00153662 predicted 949
8 SASI_Hs01_00153663 predicted 672
9 SASI_Hs01_00153664 predicted 1019
10 SASI_Hs01_00153665 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076548 predicted 875
2 SASI_Rn01_00076549 predicted 1167
3 SASI_Rn01_00076550 predicted 896
4 SASI_Rn01_00076551 predicted 1241
5 SASI_Rn01_00076552 predicted 1101
6 SASI_Rn01_00076553 predicted 937
7 SASI_Rn01_00076554 predicted 233
8 SASI_Rn02_00202982 predicted 873
9 SASI_Rn01_00076555 predicted 872
10 SASI_Rn01_00076557 predicted 202
11 SASI_Rn01_00076556 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146431 predicted 343
2 SASI_Mm01_00146432 predicted 1180
3 SASI_Mm01_00146433 predicted 1206
4 SASI_Mm01_00146434 predicted 356
5 SASI_Mm01_00146435 predicted 1098
6 SASI_Mm01_00146436 predicted 320
7 SASI_Mm01_00146437 predicted 1100
8 SASI_Mm01_00146438 predicted 1217
9 SASI_Mm01_00146439 predicted 982
10 SASI_Mm01_00146440 predicted 1295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018101
VALIDATED
CDCA8 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018101.1-2014s1c1
Sequence:CCGGCCCTGGAGAATCATGTGCTATCTCGAGATAGCACATGATTCTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018101.1-383s1c1
Sequence:CCGGCCTGGATATCACCGAAATAAACTCGAGTTTATTTCGGTGATATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018101.1-686s1c1
Sequence:CCGGGTTTGACTCAAGGGTCTTCAACTCGAGTTGAAGACCCTTGAGTCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018101.1-176s1c1
Sequence:CCGGCGCCTCCTTTCTGAAAGACTTCTCGAGAAGTCTTTCAGAAAGGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018101.1-453s1c1
Sequence:CCGGCGAAAGGTAATACAGGTAGATCTCGAGATCTACCTGTATTACCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018101.2-812s21c1
Sequence:CCGGCGGAGAGAGCCTGCGATTATTCTCGAGAATAATCGCAGGCTCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018101.2-1375s21c1
Sequence:CCGGTGCTTGAGACCGGGAGGTTTACTCGAGTAAACCTCCCGGTCTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018101.2-722s21c1
Sequence:CCGGAGCAGCAGGAGAGCGGATTTACTCGAGTAAATCCGCTCTCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018101.2-680s21c1
Sequence:CCGGGTTTGACTCAAGGGTCTTCAACTCGAGTTGAAGACCCTTGAGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018101.2-377s21c1
Sequence:CCGGCCTGGATATCACCGAAATAAACTCGAGTTTATTTCGGTGATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018101
VALIDATED
CDCA8 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018101.1-2014s1c1
Sequence:CCGGCCCTGGAGAATCATGTGCTATCTCGAGATAGCACATGATTCTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018101.1-383s1c1
Sequence:CCGGCCTGGATATCACCGAAATAAACTCGAGTTTATTTCGGTGATATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018101.1-686s1c1
Sequence:CCGGGTTTGACTCAAGGGTCTTCAACTCGAGTTGAAGACCCTTGAGTCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018101.1-176s1c1
Sequence:CCGGCGCCTCCTTTCTGAAAGACTTCTCGAGAAGTCTTTCAGAAAGGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018101.1-453s1c1
Sequence:CCGGCGAAAGGTAATACAGGTAGATCTCGAGATCTACCTGTATTACCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018101.2-812s21c1
Sequence:CCGGCGGAGAGAGCCTGCGATTATTCTCGAGAATAATCGCAGGCTCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018101.2-1375s21c1
Sequence:CCGGTGCTTGAGACCGGGAGGTTTACTCGAGTAAACCTCCCGGTCTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018101.2-722s21c1
Sequence:CCGGAGCAGCAGGAGAGCGGATTTACTCGAGTAAATCCGCTCTCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018101.2-680s21c1
Sequence:CCGGGTTTGACTCAAGGGTCTTCAACTCGAGTTGAAGACCCTTGAGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018101.2-377s21c1
Sequence:CCGGCCTGGATATCACCGAAATAAACTCGAGTTTATTTCGGTGATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018101
VALIDATED
CDCA8 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018101.1-2014s1c1
Sequence:CCGGCCCTGGAGAATCATGTGCTATCTCGAGATAGCACATGATTCTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018101.1-383s1c1
Sequence:CCGGCCTGGATATCACCGAAATAAACTCGAGTTTATTTCGGTGATATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018101.1-686s1c1
Sequence:CCGGGTTTGACTCAAGGGTCTTCAACTCGAGTTGAAGACCCTTGAGTCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018101.1-176s1c1
Sequence:CCGGCGCCTCCTTTCTGAAAGACTTCTCGAGAAGTCTTTCAGAAAGGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018101.1-453s1c1
Sequence:CCGGCGAAAGGTAATACAGGTAGATCTCGAGATCTACCTGTATTACCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018101.2-812s21c1
Sequence:CCGGCGGAGAGAGCCTGCGATTATTCTCGAGAATAATCGCAGGCTCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018101.2-1375s21c1
Sequence:CCGGTGCTTGAGACCGGGAGGTTTACTCGAGTAAACCTCCCGGTCTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018101.2-722s21c1
Sequence:CCGGAGCAGCAGGAGAGCGGATTTACTCGAGTAAATCCGCTCTCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018101.2-680s21c1
Sequence:CCGGGTTTGACTCAAGGGTCTTCAACTCGAGTTGAAGACCCTTGAGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018101.2-377s21c1
Sequence:CCGGCCTGGATATCACCGAAATAAACTCGAGTTTATTTCGGTGATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026560
VALIDATED
CDCA8 MISSION shRNA Bacterial Glycerol Stock
cell division cycle associated 8
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026560.1-464s1c1
Sequence:CCGGGCTGAAGCTATTCAGACACCTCTCGAGAGGTGTCTGAATAGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026560.1-364s1c1
Sequence:CCGGGATGAAGTGGCTTGACTACTTCTCGAGAAGTAGTCAAGCCACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026560.1-454s1c1
Sequence:CCGGCAATTTAACAGCTGAAGCTATCTCGAGATAGCTTCAGCTGTTAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026560.1-478s1c1
Sequence:CCGGGACACCTTTGAAATCTGTTAACTCGAGTTAACAGATTTCAAAGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026560.1-320s1c1
Sequence:CCGGCTGTACAACATCGAGATCCTTCTCGAGAAGGATCTCGATGTTGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026560.1-465s1c1
Sequence:CCGGCTGAAGCTATTCAGACACCTTCTCGAGAAGGTGTCTGAATAGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026560
VALIDATED
CDCA8 MISSION shRNA shRNA Plasmid DNA
cell division cycle associated 8
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026560.1-464s1c1
Sequence:CCGGGCTGAAGCTATTCAGACACCTCTCGAGAGGTGTCTGAATAGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026560.1-364s1c1
Sequence:CCGGGATGAAGTGGCTTGACTACTTCTCGAGAAGTAGTCAAGCCACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026560.1-454s1c1
Sequence:CCGGCAATTTAACAGCTGAAGCTATCTCGAGATAGCTTCAGCTGTTAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026560.1-478s1c1
Sequence:CCGGGACACCTTTGAAATCTGTTAACTCGAGTTAACAGATTTCAAAGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026560.1-320s1c1
Sequence:CCGGCTGTACAACATCGAGATCCTTCTCGAGAAGGATCTCGATGTTGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026560.1-465s1c1
Sequence:CCGGCTGAAGCTATTCAGACACCTTCTCGAGAAGGTGTCTGAATAGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026560
VALIDATED
CDCA8 MISSION shRNA Lentiviral Transduction Particles
cell division cycle associated 8
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026560.1-464s1c1
Sequence:CCGGGCTGAAGCTATTCAGACACCTCTCGAGAGGTGTCTGAATAGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026560.1-364s1c1
Sequence:CCGGGATGAAGTGGCTTGACTACTTCTCGAGAAGTAGTCAAGCCACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026560.1-454s1c1
Sequence:CCGGCAATTTAACAGCTGAAGCTATCTCGAGATAGCTTCAGCTGTTAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026560.1-478s1c1
Sequence:CCGGGACACCTTTGAAATCTGTTAACTCGAGTTAACAGATTTCAAAGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026560.1-320s1c1
Sequence:CCGGCTGTACAACATCGAGATCCTTCTCGAGAAGGATCTCGATGTTGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026560.1-465s1c1
Sequence:CCGGCTGAAGCTATTCAGACACCTTCTCGAGAAGGTGTCTGAATAGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks