EMAIL THIS PAGE TO A FRIEND

CDCP1

CUB domain containing protein 1

88 Gene Product Result for
Synonyms: CD318 SIMA135 TRASK
Gene ID:
Human(64866) Summary: This gene encodes a transmembrane protein which contains three extracellular CUB domains and acts as a substrate for Src family kinases. The protein plays a role in the tyrosine phosphorylation-dependent regulation of cellular events that are involved in tumor invasion and metastasis. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Mouse(109332) CUB domain containing protein 1
Rat(301082) CUB domain containing protein 1
chicken(420703) CUB domain containing protein 1
domestic cat(101092249) CUB domain containing protein 1
Horse(100065703) CUB domain containing protein 1
cow(540622) CUB domain containing protein 1
dog(484797) CUB domain containing protein 1
sheep(101105034) CUB domain containing protein 1
Domestic Rabbit(100347983) CUB domain containing protein 1
naked mole-rat(101700801) CUB domain containing protein 1
domestic guinea pig(100716671) CUB domain containing protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022842 Rosetta Predictions human pricing
NM_178181 Rosetta Predictions human pricing
NM_001106869 Rosetta Predictions rat pricing
NM_133974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047185 predicted 764
2 SASI_Hs01_00047186 predicted 539
3 SASI_Hs01_00047187 predicted 354
4 SASI_Hs01_00047188 predicted 382
5 SASI_Hs01_00047189 predicted 296
6 SASI_Hs01_00047190 predicted 383
7 SASI_Hs01_00047191 predicted 885
8 SASI_Hs01_00047192 predicted 478
9 SASI_Hs01_00047193 predicted 242
10 SASI_Hs01_00047194 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077678 predicted 763
2 SASI_Hs01_00077679 predicted 535
3 SASI_Hs01_00077680 predicted 347
4 SASI_Hs01_00077681 predicted 387
5 SASI_Hs01_00077682 predicted 290
6 SASI_Hs01_00077683 predicted 378
7 SASI_Hs01_00077684 predicted 884
8 SASI_Hs01_00077685 predicted 476
9 SASI_Hs01_00077686 predicted 248
10 SASI_Hs01_00077687 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223206 predicted 1123
2 SASI_Rn02_00223207 predicted 2649
3 SASI_Rn02_00223208 predicted 1211
4 SASI_Rn02_00223209 predicted 790
5 SASI_Rn02_00223210 predicted 2295
6 SASI_Rn02_00223211 predicted 692
7 SASI_Rn02_00223212 predicted 2015
8 SASI_Rn02_00223213 predicted 266
9 SASI_Rn02_00223214 predicted 753
10 SASI_Rn02_00223215 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181417 predicted 2298
2 SASI_Mm01_00181418 predicted 800
3 SASI_Mm01_00181419 predicted 316
4 SASI_Mm01_00181420 predicted 1447
5 SASI_Mm01_00181421 predicted 865
6 SASI_Mm01_00181422 predicted 758
7 SASI_Mm01_00181423 predicted 1424
8 SASI_Mm01_00181424 predicted 197
9 SASI_Mm01_00181425 predicted 1535
10 SASI_Mm01_00181426 predicted 1885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178181
VALIDATED
CDCP1 MISSION shRNA Bacterial Glycerol Stock
CUB domain containing protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178181.1-688s1c1
Sequence:CCGGCGGATCAAGATGCAAGAAGGACTCGAGTCCTTCTTGCATCTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-764s1c1
Sequence:CCGGGCATTGCAAACCGCTCATCTACTCGAGTAGATGAGCGGTTTGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-526s1c1
Sequence:CCGGGCTCATAAGAGCATCGGTTTACTCGAGTAAACCGATGCTCTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178181.1-924s1c1
Sequence:CCGGCGTCTCCTTCCTCAACTTCAACTCGAGTTGAAGTTGAGGAAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-341s1c1
Sequence:CCGGCCATCAAGTCTGGAGAAAGAACTCGAGTTCTTTCTCCAGACTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178181.1-765s1c1
Sequence:CCGGCATTGCAAACCGCTCATCTATCTCGAGATAGATGAGCGGTTTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178181.1-489s1c1
Sequence:CCGGGCCTACCCTCAACAGAACTTTCTCGAGAAAGTTCTGTTGAGGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-399s1c1
Sequence:CCGGCTTTGTCATAGAGATCCAGAACTCGAGTTCTGGATCTCTATGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_178181.1-388s1c1
Sequence:CCGGCCTGAGAATCACTTTGTCATACTCGAGTATGACAAAGTGATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178181
VALIDATED
CDCP1 MISSION shRNA shRNA Plasmid DNA
CUB domain containing protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178181.1-688s1c1
Sequence:CCGGCGGATCAAGATGCAAGAAGGACTCGAGTCCTTCTTGCATCTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-764s1c1
Sequence:CCGGGCATTGCAAACCGCTCATCTACTCGAGTAGATGAGCGGTTTGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-526s1c1
Sequence:CCGGGCTCATAAGAGCATCGGTTTACTCGAGTAAACCGATGCTCTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178181.1-924s1c1
Sequence:CCGGCGTCTCCTTCCTCAACTTCAACTCGAGTTGAAGTTGAGGAAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-341s1c1
Sequence:CCGGCCATCAAGTCTGGAGAAAGAACTCGAGTTCTTTCTCCAGACTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178181.1-765s1c1
Sequence:CCGGCATTGCAAACCGCTCATCTATCTCGAGATAGATGAGCGGTTTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178181.1-489s1c1
Sequence:CCGGGCCTACCCTCAACAGAACTTTCTCGAGAAAGTTCTGTTGAGGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-399s1c1
Sequence:CCGGCTTTGTCATAGAGATCCAGAACTCGAGTTCTGGATCTCTATGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_178181.1-388s1c1
Sequence:CCGGCCTGAGAATCACTTTGTCATACTCGAGTATGACAAAGTGATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178181
VALIDATED
CDCP1 MISSION shRNA Lentiviral Transduction Particles
CUB domain containing protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178181.1-688s1c1
Sequence:CCGGCGGATCAAGATGCAAGAAGGACTCGAGTCCTTCTTGCATCTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-764s1c1
Sequence:CCGGGCATTGCAAACCGCTCATCTACTCGAGTAGATGAGCGGTTTGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-526s1c1
Sequence:CCGGGCTCATAAGAGCATCGGTTTACTCGAGTAAACCGATGCTCTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178181.1-924s1c1
Sequence:CCGGCGTCTCCTTCCTCAACTTCAACTCGAGTTGAAGTTGAGGAAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-341s1c1
Sequence:CCGGCCATCAAGTCTGGAGAAAGAACTCGAGTTCTTTCTCCAGACTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178181.1-765s1c1
Sequence:CCGGCATTGCAAACCGCTCATCTATCTCGAGATAGATGAGCGGTTTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178181.1-489s1c1
Sequence:CCGGGCCTACCCTCAACAGAACTTTCTCGAGAAAGTTCTGTTGAGGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_178181.1-399s1c1
Sequence:CCGGCTTTGTCATAGAGATCCAGAACTCGAGTTCTGGATCTCTATGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_178181.1-388s1c1
Sequence:CCGGCCTGAGAATCACTTTGTCATACTCGAGTATGACAAAGTGATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133974
CDCP1 MISSION shRNA Bacterial Glycerol Stock
CUB domain containing protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-2232s1c1
Sequence:CCGGTGTGGGTATCTATAATGGCAACTCGAGTTGCCATTATAGATACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-303s1c1
Sequence:CCGGCGTCATGTCTAGACAGCATATCTCGAGATATGCTGTCTAGACATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-2175s1c1
Sequence:CCGGCCTGGTACTCATCATCTGCTTCTCGAGAAGCAGATGATGAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-927s1c1
Sequence:CCGGCCTCAACTTCAATGTCTCCAACTCGAGTTGGAGACATTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133974.2-3243s1c1
Sequence:CCGGCCATCAAGTATGCAGTGAATTCTCGAGAATTCACTGCATACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133974
CDCP1 MISSION shRNA shRNA Plasmid DNA
CUB domain containing protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-2232s1c1
Sequence:CCGGTGTGGGTATCTATAATGGCAACTCGAGTTGCCATTATAGATACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-303s1c1
Sequence:CCGGCGTCATGTCTAGACAGCATATCTCGAGATATGCTGTCTAGACATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-2175s1c1
Sequence:CCGGCCTGGTACTCATCATCTGCTTCTCGAGAAGCAGATGATGAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-927s1c1
Sequence:CCGGCCTCAACTTCAATGTCTCCAACTCGAGTTGGAGACATTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133974.2-3243s1c1
Sequence:CCGGCCATCAAGTATGCAGTGAATTCTCGAGAATTCACTGCATACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133974
CDCP1 MISSION shRNA Lentiviral Transduction Particles
CUB domain containing protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-2232s1c1
Sequence:CCGGTGTGGGTATCTATAATGGCAACTCGAGTTGCCATTATAGATACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-303s1c1
Sequence:CCGGCGTCATGTCTAGACAGCATATCTCGAGATATGCTGTCTAGACATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-2175s1c1
Sequence:CCGGCCTGGTACTCATCATCTGCTTCTCGAGAAGCAGATGATGAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133974.2-927s1c1
Sequence:CCGGCCTCAACTTCAATGTCTCCAACTCGAGTTGGAGACATTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133974.2-3243s1c1
Sequence:CCGGCCATCAAGTATGCAGTGAATTCTCGAGAATTCACTGCATACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks