EMAIL THIS PAGE TO A FRIEND

CDCP2

CUB domain containing protein 2

59 Gene Product Result for
UniProtKB ID: Q5VXM1, Q6ZWJ3
Gene ID:
Mouse(242603) CUB domain containing protein 2
Rat(298306) CUB domain containing protein 2
Zebrafish(567759) CUB domain containing protein 2
cow(516320) CUB domain containing protein 2
domestic cat(101094036) CUB domain containing protein 2
dog(489579) CUB domain containing protein 2
chicken(424658) CUB domain containing protein 2
domestic guinea pig(100735159) CUB domain containing protein 2
naked mole-rat(101712522) CUB domain containing protein 2
sheep(101117722) CUB domain containing protein 2
Domestic Rabbit(100344489) CUB domain containing protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_201546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201546 Rosetta Predictions human pricing
XM_233272 Rosetta Predictions rat pricing
XR_008291 Rosetta Predictions rat pricing
NM_172873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122328 predicted 1320
2 SASI_Hs01_00122330 predicted 1051
3 SASI_Hs01_00122331 predicted 1579
4 SASI_Hs01_00122333 predicted 1097
5 SASI_Hs01_00122334 predicted 1426
6 SASI_Hs01_00122335 predicted 1342
7 SASI_Hs01_00122336 predicted 1193
8 SASI_Hs02_00373033 predicted 1216
9 SASI_Hs01_00122337 predicted 1582
10 SASI_Hs02_00373034 predicted 1059
11 SASI_Hs01_00122329 predicted 1781
12 SASI_Hs01_00122332 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387572 predicted 544
2 SASI_Rn02_00387573 predicted 247
3 SASI_Rn02_00387574 predicted 244
4 SASI_Rn02_00387575 predicted 273
5 SASI_Rn02_00387576 predicted 272
6 SASI_Rn02_00387577 predicted 1487
7 SASI_Rn02_00387578 predicted 201
8 SASI_Rn02_00387579 predicted 346
9 SASI_Rn02_00387580 predicted 1508
10 SASI_Rn02_00387581 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161193 predicted 541
2 SASI_Rn02_00416671 predicted 249
3 SASI_Rn02_00416672 predicted 246
4 SASI_Rn02_00416673 predicted 279
5 SASI_Rn02_00416674 predicted 279
6 SASI_Rn02_00416675 predicted 1509
7 SASI_Rn02_00416676 predicted 199
8 SASI_Rn02_00416677 predicted 345
9 SASI_Rn01_00161201 predicted 1528
10 SASI_Rn02_00416678 predicted 364
11 SASI_Rn01_00161194 predicted 1224
12 SASI_Rn01_00161195 predicted 1230
13 SASI_Rn01_00161196 predicted 1476
14 SASI_Rn01_00161197 predicted 749
15 SASI_Rn01_00161198 predicted 1247
16 SASI_Rn01_00161199 predicted 1254
17 SASI_Rn01_00161200 predicted 1231
18 SASI_Rn01_00161202 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041933 predicted 1103
2 SASI_Mm01_00041934 predicted 1500
3 SASI_Mm01_00041936 predicted 2245
4 SASI_Mm01_00041937 predicted 1162
5 SASI_Mm01_00041938 predicted 2377
6 SASI_Mm02_00344844 predicted 1733
7 SASI_Mm01_00041939 predicted 1354
8 SASI_Mm01_00041940 predicted 1179
9 SASI_Mm01_00041941 predicted 915
10 SASI_Mm01_00041942 predicted 880
11 SASI_Mm01_00041935 predicted 1978
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172873
CDCP2 MISSION shRNA Bacterial Glycerol Stock
CUB domain containing protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172873.1-947s1c1
Sequence:CCGGCCCAAACTTCCCAAGTCTGTACTCGAGTACAGACTTGGGAAGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172873.1-2067s1c1
Sequence:CCGGGCCCTCATTTATTTCCACTGTCTCGAGACAGTGGAAATAAATGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172873.3-2154s1c1
Sequence:CCGGCTCTCTGCCTCTTGGATATTTCTCGAGAAATATCCAAGAGGCAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-1398s21c1
Sequence:CCGGGCAGCGACGAATGCATGTATGCTCGAGCATACATGCATTCGTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-2058s21c1
Sequence:CCGGCCAGTACGGCCCTCATTTATTCTCGAGAATAAATGAGGGCCGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172873.3-2154s21c1
Sequence:CCGGCTCTCTGCCTCTTGGATATTTCTCGAGAAATATCCAAGAGGCAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-1173s21c1
Sequence:CCGGACGTCATGTCTGTCGTCTTTCCTCGAGGAAAGACGACAGACATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-1033s21c1
Sequence:CCGGCCACGCCTTTGACCTGGAATACTCGAGTATTCCAGGTCAAAGGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172873
CDCP2 MISSION shRNA shRNA Plasmid DNA
CUB domain containing protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172873.1-947s1c1
Sequence:CCGGCCCAAACTTCCCAAGTCTGTACTCGAGTACAGACTTGGGAAGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172873.1-2067s1c1
Sequence:CCGGGCCCTCATTTATTTCCACTGTCTCGAGACAGTGGAAATAAATGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172873.3-2154s1c1
Sequence:CCGGCTCTCTGCCTCTTGGATATTTCTCGAGAAATATCCAAGAGGCAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-1398s21c1
Sequence:CCGGGCAGCGACGAATGCATGTATGCTCGAGCATACATGCATTCGTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-2058s21c1
Sequence:CCGGCCAGTACGGCCCTCATTTATTCTCGAGAATAAATGAGGGCCGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172873.3-2154s21c1
Sequence:CCGGCTCTCTGCCTCTTGGATATTTCTCGAGAAATATCCAAGAGGCAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-1173s21c1
Sequence:CCGGACGTCATGTCTGTCGTCTTTCCTCGAGGAAAGACGACAGACATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-1033s21c1
Sequence:CCGGCCACGCCTTTGACCTGGAATACTCGAGTATTCCAGGTCAAAGGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172873
CDCP2 MISSION shRNA Lentiviral Transduction Particles
CUB domain containing protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172873.1-947s1c1
Sequence:CCGGCCCAAACTTCCCAAGTCTGTACTCGAGTACAGACTTGGGAAGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172873.1-2067s1c1
Sequence:CCGGGCCCTCATTTATTTCCACTGTCTCGAGACAGTGGAAATAAATGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172873.3-2154s1c1
Sequence:CCGGCTCTCTGCCTCTTGGATATTTCTCGAGAAATATCCAAGAGGCAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-1398s21c1
Sequence:CCGGGCAGCGACGAATGCATGTATGCTCGAGCATACATGCATTCGTCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-2058s21c1
Sequence:CCGGCCAGTACGGCCCTCATTTATTCTCGAGAATAAATGAGGGCCGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172873.3-2154s21c1
Sequence:CCGGCTCTCTGCCTCTTGGATATTTCTCGAGAAATATCCAAGAGGCAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-1173s21c1
Sequence:CCGGACGTCATGTCTGTCGTCTTTCCTCGAGGAAAGACGACAGACATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172873.3-1033s21c1
Sequence:CCGGCCACGCCTTTGACCTGGAATACTCGAGTATTCCAGGTCAAAGGCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201546
CDCP2 MISSION shRNA Bacterial Glycerol Stock
CUB domain containing protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1235s1c1
Sequence:CCGGGCATGTCATGTCTGTCATCTTCTCGAGAAGATGACAGACATGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1293s1c1
Sequence:CCGGGCGGGCTACCAGAAAGGTCAACTCGAGTTGACCTTTCTGGTAGCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1130s1c1
Sequence:CCGGCAGCTTCGACTTTCTGGAGATCTCGAGATCTCCAGAAAGTCGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-983s1c1
Sequence:CCGGCTCAGCACCTTCTGGAAACTTCTCGAGAAGTTTCCAGAAGGTGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1097s1c1
Sequence:CCGGCCATGCCTTTGACCTAGAGTACTCGAGTACTCTAGGTCAAAGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201546.2-917s21c1
Sequence:CCGGAGCCATGGAAGGTGTCAAATGCTCGAGCATTTGACACCTTCCATGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201546.2-2367s21c1
Sequence:CCGGATCATTCAGAACTACTCATTGCTCGAGCAATGAGTAGTTCTGAATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201546.2-2457s21c1
Sequence:CCGGGGGCTCAACACTGTTCCAAATCTCGAGATTTGGAACAGTGTTGAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201546
CDCP2 MISSION shRNA shRNA Plasmid DNA
CUB domain containing protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1235s1c1
Sequence:CCGGGCATGTCATGTCTGTCATCTTCTCGAGAAGATGACAGACATGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1293s1c1
Sequence:CCGGGCGGGCTACCAGAAAGGTCAACTCGAGTTGACCTTTCTGGTAGCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1130s1c1
Sequence:CCGGCAGCTTCGACTTTCTGGAGATCTCGAGATCTCCAGAAAGTCGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-983s1c1
Sequence:CCGGCTCAGCACCTTCTGGAAACTTCTCGAGAAGTTTCCAGAAGGTGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1097s1c1
Sequence:CCGGCCATGCCTTTGACCTAGAGTACTCGAGTACTCTAGGTCAAAGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201546.2-917s21c1
Sequence:CCGGAGCCATGGAAGGTGTCAAATGCTCGAGCATTTGACACCTTCCATGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201546.2-2367s21c1
Sequence:CCGGATCATTCAGAACTACTCATTGCTCGAGCAATGAGTAGTTCTGAATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201546.2-2457s21c1
Sequence:CCGGGGGCTCAACACTGTTCCAAATCTCGAGATTTGGAACAGTGTTGAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201546
CDCP2 MISSION shRNA Lentiviral Transduction Particles
CUB domain containing protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1235s1c1
Sequence:CCGGGCATGTCATGTCTGTCATCTTCTCGAGAAGATGACAGACATGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1293s1c1
Sequence:CCGGGCGGGCTACCAGAAAGGTCAACTCGAGTTGACCTTTCTGGTAGCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1130s1c1
Sequence:CCGGCAGCTTCGACTTTCTGGAGATCTCGAGATCTCCAGAAAGTCGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-983s1c1
Sequence:CCGGCTCAGCACCTTCTGGAAACTTCTCGAGAAGTTTCCAGAAGGTGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201546.1-1097s1c1
Sequence:CCGGCCATGCCTTTGACCTAGAGTACTCGAGTACTCTAGGTCAAAGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201546.2-917s21c1
Sequence:CCGGAGCCATGGAAGGTGTCAAATGCTCGAGCATTTGACACCTTCCATGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201546.2-2367s21c1
Sequence:CCGGATCATTCAGAACTACTCATTGCTCGAGCAATGAGTAGTTCTGAATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201546.2-2457s21c1
Sequence:CCGGGGGCTCAACACTGTTCCAAATCTCGAGATTTGGAACAGTGTTGAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)