EMAIL THIS PAGE TO A FRIEND

CDH10

cadherin 10, type 2 (T2-cadherin)

UniProtKB ID: Q9Y6N8, Q9ULB3
Gene ID:
Human(1008) Summary: This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is predominantly expressed in brain and is putatively involved in synaptic adhesions, axon outgrowth and guidance. [provided by RefSeq, Jan 2011]
Mouse(320873) cadherin 10
Rat(29181) cadherin 10
Zebrafish(568370) cadherin 10, type 2 (T2-cadherin)
cow(541259) cadherin 10, type 2 (T2-cadherin)
Horse(100054334) cadherin 10, type 2 (T2-cadherin)
chicken(408049) cadherin 10, type 2 (T2-cadherin)
domestic cat(101086288) cadherin 10, type 2 (T2-cadherin)
dog(489248) cadherin 10, type 2 (T2-cadherin)
sheep(101117364) cadherin 10, type 2 (T2-cadherin)
Domestic Rabbit(100343059) cadherin 10, type 2 (T2-cadherin)
naked mole-rat(101707219) cadherin 10, type 2 (T2-cadherin)
Gene Class: Calcium_Binding
181 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006727 Rosetta Predictions human pricing
XM_001058161 Rosetta Predictions rat pricing
XM_001058227 Rosetta Predictions rat pricing
XM_001058286 Rosetta Predictions rat pricing
XM_001058358 Rosetta Predictions rat pricing
XM_342202 Rosetta Predictions rat pricing
NM_009865 Rosetta Predictions mouse pricing
XM_283264 Rosetta Predictions mouse pricing
XM_887935 Rosetta Predictions mouse pricing
XM_897767 Rosetta Predictions mouse pricing
XM_897787 Rosetta Predictions mouse pricing
XM_897798 Rosetta Predictions mouse pricing
XM_983229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211532 predicted 972
2 SASI_Hs01_00211533 predicted 2287
3 SASI_Hs01_00211535 predicted 1189
4 SASI_Hs01_00211536 predicted 2395
5 SASI_Hs02_00342162 predicted 1266
6 SASI_Hs01_00211538 predicted 840
7 SASI_Hs01_00211539 predicted 1492
8 SASI_Hs01_00211540 predicted 2197
9 SASI_Hs01_00211541 predicted 667
10 SASI_Hs02_00342163 predicted 1521
11 SASI_Hs01_00211534 predicted 1623
12 SASI_Hs01_00211537 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288805 predicted 1871
2 SASI_Rn02_00288806 predicted 1529
3 SASI_Rn02_00288807 predicted 2473
4 SASI_Rn02_00288808 predicted 1546
5 SASI_Rn02_00288809 predicted 1330
6 SASI_Rn02_00288810 predicted 2440
7 SASI_Rn02_00288811 predicted 1187
8 SASI_Rn02_00288812 predicted 1778
9 SASI_Rn02_00288813 predicted 2289
10 SASI_Rn02_00288814 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289037 predicted 1868
2 SASI_Rn02_00289038 predicted 1526
3 SASI_Rn02_00289039 predicted 2495
4 SASI_Rn02_00289040 predicted 1066
5 SASI_Rn02_00289041 predicted 1551
6 SASI_Rn02_00289042 predicted 1332
7 SASI_Rn02_00289043 predicted 2466
8 SASI_Rn02_00289044 predicted 1189
9 SASI_Rn02_00289045 predicted 2116
10 SASI_Rn02_00289046 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289216 predicted 532
2 SASI_Rn02_00289217 predicted 2103
3 SASI_Rn02_00289218 predicted 1758
4 SASI_Rn02_00289219 predicted 2726
5 SASI_Rn02_00289220 predicted 1774
6 SASI_Rn02_00289221 predicted 1554
7 SASI_Rn02_00289222 predicted 2695
8 SASI_Rn02_00289223 predicted 1417
9 SASI_Rn02_00289224 predicted 2349
10 SASI_Rn02_00289225 predicted 2004
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289411 predicted 302
2 SASI_Rn02_00289412 predicted 1869
3 SASI_Rn02_00289413 predicted 1527
4 SASI_Rn02_00289414 predicted 2495
5 SASI_Rn02_00289415 predicted 1542
6 SASI_Rn02_00289416 predicted 1324
7 SASI_Rn02_00289417 predicted 2471
8 SASI_Rn02_00289418 predicted 1189
9 SASI_Rn02_00289419 predicted 2124
10 SASI_Rn02_00289420 predicted 1774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393906 predicted 303
2 SASI_Rn02_00393907 predicted 1525
3 SASI_Rn02_00393908 predicted 1551
4 SASI_Rn02_00393909 predicted 1329
5 SASI_Rn02_00393910 predicted 1542
6 SASI_Rn02_00393911 predicted 1187
7 SASI_Rn02_00393912 predicted 440
8 SASI_Rn02_00393913 predicted 772
9 SASI_Rn02_00393914 predicted 717
10 SASI_Rn02_00393915 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317298 predicted 1862
2 SASI_Mm02_00317299 predicted 2009
3 SASI_Mm02_00317300 predicted 2100
4 SASI_Mm02_00317301 predicted 2396
5 SASI_Mm02_00317302 predicted 2543
6 SASI_Mm02_00317303 predicted 1419
7 SASI_Mm02_00317304 predicted 2031
8 SASI_Mm02_00317305 predicted 822
9 SASI_Mm02_00317306 predicted 2350
10 SASI_Mm02_00317307 predicted 2697
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261093 predicted 2733
2 SASI_Mm01_00261094 predicted 2176
3 SASI_Mm01_00261095 predicted 2324
4 SASI_Mm01_00261096 predicted 2768
5 SASI_Mm01_00261097 predicted 2129
6 SASI_Mm01_00261098 predicted 2106
7 SASI_Mm01_00261099 predicted 2892
8 SASI_Mm01_00261100 predicted 2473
9 SASI_Mm01_00261101 predicted 2167
10 SASI_Mm01_00261102 predicted 2794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264396 predicted 2966
2 SASI_Mm01_00264397 predicted 2398
3 SASI_Mm01_00264398 predicted 2550
4 SASI_Mm01_00264399 predicted 2992
5 SASI_Mm01_00264400 predicted 2360
6 SASI_Mm01_00264401 predicted 2336
7 SASI_Mm01_00264402 predicted 3123
8 SASI_Mm01_00264403 predicted 2706
9 SASI_Mm01_00264404 predicted 2404
10 SASI_Mm01_00264405 predicted 3027
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225318 predicted 457
2 SASI_Mm01_00225319 predicted 454
3 SASI_Mm01_00225320 predicted 447
4 SASI_Mm01_00225321 predicted 454
5 SASI_Mm01_00225322 predicted 454
6 SASI_Mm01_00225323 predicted 448
7 SASI_Mm01_00225324 predicted 334
8 SASI_Mm01_00225325 predicted 339
9 SASI_Mm01_00225326 predicted 453
10 SASI_Mm01_00225327 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268833 predicted 2165
2 SASI_Mm01_00268834 predicted 2014
3 SASI_Mm01_00268835 predicted 2063
4 SASI_Mm01_00268836 predicted 2033
5 SASI_Mm01_00268837 predicted 2157
6 SASI_Mm01_00268838 predicted 1748
7 SASI_Mm01_00268839 predicted 2055
8 SASI_Mm01_00268840 predicted 2003
9 SASI_Mm01_00268841 predicted 1994
10 SASI_Mm01_00268842 predicted 2061
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273130 predicted 1545
2 SASI_Mm01_00273131 predicted 972
3 SASI_Mm01_00273132 predicted 1117
4 SASI_Mm01_00273133 predicted 1372
5 SASI_Mm01_00273134 predicted 928
6 SASI_Mm01_00273135 predicted 1689
7 SASI_Mm01_00273136 predicted 1272
8 SASI_Mm01_00273137 predicted 1594
9 SASI_Mm01_00273138 predicted 1646
10 SASI_Mm01_00273139 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261490 predicted 2766
2 SASI_Mm01_00261491 predicted 2200
3 SASI_Mm01_00261492 predicted 2356
4 SASI_Mm01_00261493 predicted 2799
5 SASI_Mm01_00261494 predicted 2160
6 SASI_Mm01_00261495 predicted 2131
7 SASI_Mm01_00261496 predicted 2917
8 SASI_Mm01_00261497 predicted 2509
9 SASI_Mm01_00261498 predicted 2203
10 SASI_Mm01_00261499 predicted 2824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006727
CDH10 MISSION shRNA Bacterial Glycerol Stock
cadherin 10, type 2 (T2-cadherin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-1531s1c1
Sequence:CCGGGCACAATCATTGGTACTGTAACTCGAGTTACAGTACCAATGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-1353s1c1
Sequence:CCGGCGAAGACTTTATACTCTGAAACTCGAGTTTCAGAGTATAAAGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-2643s1c1
Sequence:CCGGCGGTTTAATAAGCTAGCAGAACTCGAGTTCTGCTAGCTTATTAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-2391s1c1
Sequence:CCGGCGGCGAGATATTATTCCAGAACTCGAGTTCTGGAATAATATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-1268s1c1
Sequence:CCGGCGGTACTGATATGTTTGACATCTCGAGATGTCAAACATATCAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006727.2-2193s21c1
Sequence:CCGGATCATCATTCTACTGGTTATACTCGAGTATAACCAGTAGAATGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006727.2-2691s21c1
Sequence:CCGGGACTCTTAACGTAGGATATATCTCGAGATATATCCTACGTTAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006727.2-710s21c1
Sequence:CCGGTCTACGCGCACAAGCTATTAACTCGAGTTAATAGCTTGTGCGCGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006727
CDH10 MISSION shRNA shRNA Plasmid DNA
cadherin 10, type 2 (T2-cadherin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-1531s1c1
Sequence:CCGGGCACAATCATTGGTACTGTAACTCGAGTTACAGTACCAATGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-1353s1c1
Sequence:CCGGCGAAGACTTTATACTCTGAAACTCGAGTTTCAGAGTATAAAGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-2643s1c1
Sequence:CCGGCGGTTTAATAAGCTAGCAGAACTCGAGTTCTGCTAGCTTATTAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-2391s1c1
Sequence:CCGGCGGCGAGATATTATTCCAGAACTCGAGTTCTGGAATAATATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-1268s1c1
Sequence:CCGGCGGTACTGATATGTTTGACATCTCGAGATGTCAAACATATCAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006727.2-2193s21c1
Sequence:CCGGATCATCATTCTACTGGTTATACTCGAGTATAACCAGTAGAATGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006727.2-2691s21c1
Sequence:CCGGGACTCTTAACGTAGGATATATCTCGAGATATATCCTACGTTAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006727.2-710s21c1
Sequence:CCGGTCTACGCGCACAAGCTATTAACTCGAGTTAATAGCTTGTGCGCGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006727
CDH10 MISSION shRNA Lentiviral Transduction Particles
cadherin 10, type 2 (T2-cadherin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-1531s1c1
Sequence:CCGGGCACAATCATTGGTACTGTAACTCGAGTTACAGTACCAATGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-1353s1c1
Sequence:CCGGCGAAGACTTTATACTCTGAAACTCGAGTTTCAGAGTATAAAGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-2643s1c1
Sequence:CCGGCGGTTTAATAAGCTAGCAGAACTCGAGTTCTGCTAGCTTATTAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-2391s1c1
Sequence:CCGGCGGCGAGATATTATTCCAGAACTCGAGTTCTGGAATAATATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006727.2-1268s1c1
Sequence:CCGGCGGTACTGATATGTTTGACATCTCGAGATGTCAAACATATCAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006727.2-2193s21c1
Sequence:CCGGATCATCATTCTACTGGTTATACTCGAGTATAACCAGTAGAATGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006727.2-2691s21c1
Sequence:CCGGGACTCTTAACGTAGGATATATCTCGAGATATATCCTACGTTAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006727.2-710s21c1
Sequence:CCGGTCTACGCGCACAAGCTATTAACTCGAGTTAATAGCTTGTGCGCGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009865
CDH10 MISSION shRNA Bacterial Glycerol Stock
cadherin 10, type 2 (T2-cadherin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-1499s21c1
Sequence:CCGGATGAGAACCGAAGACTATATACTCGAGTATATAGTCTTCGGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-1862s21c1
Sequence:CCGGTTATAGCTGCTGAGATCAATACTCGAGTATTGATCTCAGCAGCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-1393s21c1
Sequence:CCGGGAAGTGGATTACCGCATTATTCTCGAGAATAATGCGGTAATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009865.2-2957s21c1
Sequence:CCGGGCACACGTTTCCCACTTATTTCTCGAGAAATAAGTGGGAAACGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-864s21c1
Sequence:CCGGTCTACGTGCACAAGCTATTAACTCGAGTTAATAGCTTGTGCACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009865
CDH10 MISSION shRNA shRNA Plasmid DNA
cadherin 10, type 2 (T2-cadherin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-1499s21c1
Sequence:CCGGATGAGAACCGAAGACTATATACTCGAGTATATAGTCTTCGGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-1862s21c1
Sequence:CCGGTTATAGCTGCTGAGATCAATACTCGAGTATTGATCTCAGCAGCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-1393s21c1
Sequence:CCGGGAAGTGGATTACCGCATTATTCTCGAGAATAATGCGGTAATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009865.2-2957s21c1
Sequence:CCGGGCACACGTTTCCCACTTATTTCTCGAGAAATAAGTGGGAAACGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-864s21c1
Sequence:CCGGTCTACGTGCACAAGCTATTAACTCGAGTTAATAGCTTGTGCACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009865
CDH10 MISSION shRNA Lentiviral Transduction Particles
cadherin 10, type 2 (T2-cadherin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-1499s21c1
Sequence:CCGGATGAGAACCGAAGACTATATACTCGAGTATATAGTCTTCGGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-1862s21c1
Sequence:CCGGTTATAGCTGCTGAGATCAATACTCGAGTATTGATCTCAGCAGCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-1393s21c1
Sequence:CCGGGAAGTGGATTACCGCATTATTCTCGAGAATAATGCGGTAATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009865.2-2957s21c1
Sequence:CCGGGCACACGTTTCCCACTTATTTCTCGAGAAATAAGTGGGAAACGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009865.2-864s21c1
Sequence:CCGGTCTACGTGCACAAGCTATTAACTCGAGTTAATAGCTTGTGCACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks