EMAIL THIS PAGE TO A FRIEND

CDH11

cadherin 11, type 2, OB-cadherin (osteoblast)

142 Gene Product Result for
Synonyms: CAD11 CDHOB OB OSF-4
Gene ID:
Human(1009) Summary: This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Expression of this particular cadherin in osteoblastic cell lines, and its upregulation during differentiation, suggests a specific function in bone development and maintenance. [provided by RefSeq, Jul 2008]
Mouse(12552) cadherin 11
Rat(84407) cadherin 11
domestic guinea pig(100716649) cadherin 11, type 2, OB-cadherin (osteoblast)
naked mole-rat(101708158) cadherin 11, type 2, OB-cadherin (osteoblast)
sheep(101106961) cadherin 11, type 2, OB-cadherin (osteoblast)
Domestic Rabbit(100349487) cadherin 11, type 2, OB-cadherin (osteoblast)
Zebrafish(30461) cadherin 11, osteoblast
chicken(415797) cadherin 11, type 2, OB-cadherin (osteoblast)
cow(785475) cadherin 11, type 2, OB-cadherin (osteoblast)
Horse(100052714) cadherin 11, type 2, OB-cadherin (osteoblast)
domestic cat(101095064) cadherin 11, type 2, OB-cadherin (osteoblast)
dog(479696) cadherin 11, type 2, OB-cadherin (osteoblast)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001797 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029911 MISSION® esiRNA esiRNA targeting mouse Cdh11 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001797 Rosetta Predictions human pricing
XM_001055504 Rosetta Predictions rat pricing
XM_001055556 Rosetta Predictions rat pricing
XM_001059464 Rosetta Predictions rat pricing
XM_341639 Rosetta Predictions rat pricing
NM_009866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191359 predicted 1377
2 SASI_Hs02_00332566 predicted 2580
3 SASI_Hs01_00191361 predicted 1331
4 SASI_Hs02_00332567 predicted 2510
5 SASI_Hs02_00332568 predicted 2441
6 SASI_Hs02_00332569 predicted 1677
7 SASI_Hs01_00191362 predicted 1872
8 SASI_Hs01_00191363 predicted 1455
9 SASI_Hs01_00191364 predicted 1001
10 SASI_Hs01_00191365 predicted 1243
11 SASI_Hs01_00191356 predicted 2646
12 SASI_Hs01_00191357 predicted 2030
13 SASI_Hs01_00191358 predicted 2638
14 SASI_Hs01_00191360 predicted 2776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279761 predicted 2542
2 SASI_Rn02_00279762 predicted 768
3 SASI_Rn02_00279763 predicted 1437
4 SASI_Rn02_00279764 predicted 2783
5 SASI_Rn02_00279765 predicted 907
6 SASI_Rn02_00279766 predicted 1291
7 SASI_Rn02_00279767 predicted 1582
8 SASI_Rn02_00279768 predicted 1952
9 SASI_Rn02_00279769 predicted 2072
10 SASI_Rn02_00279770 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280004 predicted 2621
2 SASI_Rn02_00280005 predicted 858
3 SASI_Rn02_00280006 predicted 1524
4 SASI_Rn02_00280007 predicted 2863
5 SASI_Rn02_00280008 predicted 988
6 SASI_Rn02_00280009 predicted 1377
7 SASI_Rn02_00280010 predicted 1675
8 SASI_Rn02_00280011 predicted 1439
9 SASI_Rn02_00280012 predicted 2037
10 SASI_Rn02_00280013 predicted 2161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293305 predicted 2537
2 SASI_Rn02_00293306 predicted 766
3 SASI_Rn02_00293307 predicted 1442
4 SASI_Rn02_00293308 predicted 2781
5 SASI_Rn02_00293309 predicted 911
6 SASI_Rn02_00293310 predicted 1290
7 SASI_Rn02_00293311 predicted 1585
8 SASI_Rn02_00293312 predicted 1945
9 SASI_Rn02_00293313 predicted 2066
10 SASI_Rn02_00293314 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393201 predicted 2621
2 SASI_Rn02_00393202 predicted 859
3 SASI_Rn02_00393203 predicted 1524
4 SASI_Rn02_00393204 predicted 2861
5 SASI_Rn02_00393205 predicted 996
6 SASI_Rn02_00393206 predicted 1381
7 SASI_Rn02_00393207 predicted 1675
8 SASI_Rn02_00393208 predicted 2035
9 SASI_Rn02_00393209 predicted 2157
10 SASI_Rn02_00393210 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053348 predicted 667
2 SASI_Mm01_00053349 predicted 1537
3 SASI_Mm01_00053350 predicted 2253
4 SASI_Mm01_00053351 predicted 1079
5 SASI_Mm01_00053352 predicted 1846
6 SASI_Mm01_00053353 predicted 2592
7 SASI_Mm01_00053354 predicted 1756
8 SASI_Mm01_00053355 predicted 2112
9 SASI_Mm01_00053356 predicted 2567
10 SASI_Mm02_00317308 predicted 2595
11 SASI_Mm01_00053347 predicted 2118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009866
VALIDATED
CDH11 MISSION shRNA Bacterial Glycerol Stock
cadherin 11, type 2, OB-cadherin (osteoblast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009866.4-3295s21c1
Sequence:CCGGGAGCTGTAATTTCGCCTTAAACTCGAGTTTAAGGCGAAATTACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009866.4-2593s21c1
Sequence:CCGGTCAAACCTGAGTATCAGTATACTCGAGTATACTGATACTCAGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009866.4-2260s21c1
Sequence:CCGGCCAATACCCTCACTATCAAAGCTCGAGCTTTGATAGTGAGGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009866.4-2558s21c1
Sequence:CCGGTGACGGCATCAATGGATTTATCTCGAGATAAATCCATTGATGCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009866.4-2149s21c1
Sequence:CCGGATAACACTGCAGGAGTATATGCTCGAGCATATACTCCTGCAGTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-1853s1c1
Sequence:CCGGGCAGAAATTCACAACAGACATCTCGAGATGTCTGTTGTGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009866.3-3338s1c1
Sequence:CCGGGCCAGCTTAAACCCATACAATCTCGAGATTGTATGGGTTTAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-1517s1c1
Sequence:CCGGGCCGCCAATGTTCACATTGATCTCGAGATCAATGTGAACATTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-2045s1c1
Sequence:CCGGCCAAGATTTATCTTCAGCCTACTCGAGTAGGCTGAAGATAAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-1628s1c1
Sequence:CCGGCCAAGTTATATCCATGAAGTTCTCGAGAACTTCATGGATATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009866
VALIDATED
CDH11 MISSION shRNA shRNA Plasmid DNA
cadherin 11, type 2, OB-cadherin (osteoblast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009866.4-3295s21c1
Sequence:CCGGGAGCTGTAATTTCGCCTTAAACTCGAGTTTAAGGCGAAATTACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009866.4-2593s21c1
Sequence:CCGGTCAAACCTGAGTATCAGTATACTCGAGTATACTGATACTCAGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009866.4-2260s21c1
Sequence:CCGGCCAATACCCTCACTATCAAAGCTCGAGCTTTGATAGTGAGGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009866.4-2558s21c1
Sequence:CCGGTGACGGCATCAATGGATTTATCTCGAGATAAATCCATTGATGCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009866.4-2149s21c1
Sequence:CCGGATAACACTGCAGGAGTATATGCTCGAGCATATACTCCTGCAGTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-1853s1c1
Sequence:CCGGGCAGAAATTCACAACAGACATCTCGAGATGTCTGTTGTGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009866.3-3338s1c1
Sequence:CCGGGCCAGCTTAAACCCATACAATCTCGAGATTGTATGGGTTTAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-1517s1c1
Sequence:CCGGGCCGCCAATGTTCACATTGATCTCGAGATCAATGTGAACATTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-2045s1c1
Sequence:CCGGCCAAGATTTATCTTCAGCCTACTCGAGTAGGCTGAAGATAAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-1628s1c1
Sequence:CCGGCCAAGTTATATCCATGAAGTTCTCGAGAACTTCATGGATATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009866
VALIDATED
CDH11 MISSION shRNA Lentiviral Transduction Particles
cadherin 11, type 2, OB-cadherin (osteoblast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009866.4-3295s21c1
Sequence:CCGGGAGCTGTAATTTCGCCTTAAACTCGAGTTTAAGGCGAAATTACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009866.4-2593s21c1
Sequence:CCGGTCAAACCTGAGTATCAGTATACTCGAGTATACTGATACTCAGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009866.4-2260s21c1
Sequence:CCGGCCAATACCCTCACTATCAAAGCTCGAGCTTTGATAGTGAGGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009866.4-2558s21c1
Sequence:CCGGTGACGGCATCAATGGATTTATCTCGAGATAAATCCATTGATGCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009866.4-2149s21c1
Sequence:CCGGATAACACTGCAGGAGTATATGCTCGAGCATATACTCCTGCAGTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-1853s1c1
Sequence:CCGGGCAGAAATTCACAACAGACATCTCGAGATGTCTGTTGTGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009866.3-3338s1c1
Sequence:CCGGGCCAGCTTAAACCCATACAATCTCGAGATTGTATGGGTTTAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-1517s1c1
Sequence:CCGGGCCGCCAATGTTCACATTGATCTCGAGATCAATGTGAACATTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-2045s1c1
Sequence:CCGGCCAAGATTTATCTTCAGCCTACTCGAGTAGGCTGAAGATAAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009866.3-1628s1c1
Sequence:CCGGCCAAGTTATATCCATGAAGTTCTCGAGAACTTCATGGATATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001797
CDH11 MISSION shRNA Bacterial Glycerol Stock
cadherin 11, type 2, OB-cadherin (osteoblast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-1944s21c1
Sequence:CCGGCCACTTTCCAACCAGCCAATTCTCGAGAATTGGCTGGTTGGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001797.2-3233s21c1
Sequence:CCGGTAAACTCTGGACACTCTATATCTCGAGATATAGAGTGTCCAGAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-950s21c1
Sequence:CCGGCAATGTGGGAACGTCAGTAATCTCGAGATTACTGACGTTCCCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-2589s21c1
Sequence:CCGGGACTTCATCAACACGAGAATACTCGAGTATTCTCGTGTTGATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-1704s21c1
Sequence:CCGGCACACTGACCTCGACAGATTTCTCGAGAAATCTGTCGAGGTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-2781s1c1
Sequence:CCGGGCAGATTTGTATGGTTCCAAACTCGAGTTTGGAACCATACAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-1944s1c1
Sequence:CCGGCCACTTTCCAACCAGCCAATTCTCGAGAATTGGCTGGTTGGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-1496s1c1
Sequence:CCGGCGACCCGAAGTTTATCAGCAACTCGAGTTGCTGATAAACTTCGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-1015s1c1
Sequence:CCGGGCGCCAAGTTAGTGTACAGTACTCGAGTACTGTACACTAACTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-2402s1c1
Sequence:CCGGCCGTGAGAACATCATTACTTACTCGAGTAAGTAATGATGTTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001797
CDH11 MISSION shRNA shRNA Plasmid DNA
cadherin 11, type 2, OB-cadherin (osteoblast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-1944s21c1
Sequence:CCGGCCACTTTCCAACCAGCCAATTCTCGAGAATTGGCTGGTTGGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001797.2-3233s21c1
Sequence:CCGGTAAACTCTGGACACTCTATATCTCGAGATATAGAGTGTCCAGAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-950s21c1
Sequence:CCGGCAATGTGGGAACGTCAGTAATCTCGAGATTACTGACGTTCCCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-2589s21c1
Sequence:CCGGGACTTCATCAACACGAGAATACTCGAGTATTCTCGTGTTGATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-1704s21c1
Sequence:CCGGCACACTGACCTCGACAGATTTCTCGAGAAATCTGTCGAGGTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-2781s1c1
Sequence:CCGGGCAGATTTGTATGGTTCCAAACTCGAGTTTGGAACCATACAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-1944s1c1
Sequence:CCGGCCACTTTCCAACCAGCCAATTCTCGAGAATTGGCTGGTTGGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-1496s1c1
Sequence:CCGGCGACCCGAAGTTTATCAGCAACTCGAGTTGCTGATAAACTTCGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-1015s1c1
Sequence:CCGGGCGCCAAGTTAGTGTACAGTACTCGAGTACTGTACACTAACTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-2402s1c1
Sequence:CCGGCCGTGAGAACATCATTACTTACTCGAGTAAGTAATGATGTTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001797
CDH11 MISSION shRNA Lentiviral Transduction Particles
cadherin 11, type 2, OB-cadherin (osteoblast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-1944s21c1
Sequence:CCGGCCACTTTCCAACCAGCCAATTCTCGAGAATTGGCTGGTTGGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001797.2-3233s21c1
Sequence:CCGGTAAACTCTGGACACTCTATATCTCGAGATATAGAGTGTCCAGAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-950s21c1
Sequence:CCGGCAATGTGGGAACGTCAGTAATCTCGAGATTACTGACGTTCCCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-2589s21c1
Sequence:CCGGGACTTCATCAACACGAGAATACTCGAGTATTCTCGTGTTGATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001797.2-1704s21c1
Sequence:CCGGCACACTGACCTCGACAGATTTCTCGAGAAATCTGTCGAGGTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-2781s1c1
Sequence:CCGGGCAGATTTGTATGGTTCCAAACTCGAGTTTGGAACCATACAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-1944s1c1
Sequence:CCGGCCACTTTCCAACCAGCCAATTCTCGAGAATTGGCTGGTTGGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-1496s1c1
Sequence:CCGGCGACCCGAAGTTTATCAGCAACTCGAGTTGCTGATAAACTTCGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-1015s1c1
Sequence:CCGGGCGCCAAGTTAGTGTACAGTACTCGAGTACTGTACACTAACTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001797.2-2402s1c1
Sequence:CCGGCCGTGAGAACATCATTACTTACTCGAGTAAGTAATGATGTTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks