EMAIL THIS PAGE TO A FRIEND

CDH12

cadherin 12, type 2 (N-cadherin 2)

88 Gene Product Result for
Synonyms: CDHB
UniProtKB ID: P55289, B2RBT1, Q86UD2
Gene ID:
Human(1010) Summary: This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin appears to be expressed specifically in the brain and its temporal pattern of expression would be consistent with a role during a critical period of neuronal development, perhaps specifically during synaptogenesis. [provided by RefSeq, Jul 2008]
Mouse(215654) cadherin 12
Rat(301887) cadherin 12
Zebrafish(570372) cadherin 12, type 2 (N-cadherin 2)
cow(540672) cadherin 12, type 2 (N-cadherin 2)
Horse(100054380) cadherin 12, type 2 (N-cadherin 2)
domestic cat(101085526) cadherin 12, type 2 (N-cadherin 2)
dog(489253) cadherin 12, type 2 (N-cadherin 2)
chicken(420912) cadherin 12, type 2 (N-cadherin 2)
sheep(101118385) cadherin 12, type 2 (N-cadherin 2)
Domestic Rabbit(100340496) cadherin 12, type 2 (N-cadherin 2)
naked mole-rat(101709621) cadherin 12, type 2 (N-cadherin 2)
domestic guinea pig(100718176) cadherin 12, type 2 (N-cadherin 2)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004061 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027631 MISSION® esiRNA esiRNA human CDH12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004061 Rosetta Predictions human pricing
XM_001062023 Rosetta Predictions rat pricing
XM_229369 Rosetta Predictions rat pricing
NM_001008420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020531 predicted 2928
2 SASI_Hs01_00020532 predicted 2678
3 SASI_Hs01_00020533 predicted 1724
4 SASI_Hs01_00020535 predicted 2598
5 SASI_Hs01_00020536 predicted 2044
6 SASI_Hs02_00336844 predicted 1524
7 SASI_Hs01_00020537 predicted 2212
8 SASI_Hs01_00020538 predicted 2242
9 SASI_Hs01_00020539 predicted 2513
10 SASI_Hs01_00020540 predicted 2057
11 SASI_Hs01_00020534 predicted 2651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302109 predicted 1501
2 SASI_Rn02_00302110 predicted 514
3 SASI_Rn02_00302111 predicted 1144
4 SASI_Rn02_00302112 predicted 640
5 SASI_Rn02_00302113 predicted 755
6 SASI_Rn02_00302114 predicted 614
7 SASI_Rn02_00302115 predicted 1118
8 SASI_Rn02_00302116 predicted 1189
9 SASI_Rn02_00302117 predicted 1261
10 SASI_Rn02_00302118 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385943 predicted 1500
2 SASI_Rn02_00385944 predicted 509
3 SASI_Rn02_00385945 predicted 1152
4 SASI_Rn02_00385946 predicted 638
5 SASI_Rn02_00385947 predicted 756
6 SASI_Rn02_00385948 predicted 615
7 SASI_Rn02_00385949 predicted 1114
8 SASI_Rn02_00385950 predicted 1190
9 SASI_Rn02_00385951 predicted 1264
10 SASI_Rn02_00385952 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122885 predicted 1762
2 SASI_Mm02_00286777 predicted 1442
3 SASI_Mm01_00122886 predicted 2133
4 SASI_Mm01_00122887 predicted 1517
5 SASI_Mm01_00122888 predicted 1218
6 SASI_Mm01_00122889 predicted 1167
7 SASI_Mm01_00122890 predicted 2053
8 SASI_Mm01_00122891 predicted 1284
9 SASI_Mm01_00122892 predicted 1357
10 SASI_Mm01_00122893 predicted 1945
11 SASI_Mm01_00122894 predicted 1376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008420
CDH12 MISSION shRNA Bacterial Glycerol Stock
cadherin 12, type 2 (N-cadherin 2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-846s1c1
Sequence:CCGGCAGGTGTCATTAGAACAGCATCTCGAGATGCTGTTCTAATGACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008420.1-5244s1c1
Sequence:CCGGCCAGTATTTCAATGCCTGTAACTCGAGTTACAGGCATTGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-1765s1c1
Sequence:CCGGGCAGCAATTCTCCTTTAGATTCTCGAGAATCTAAAGGAGAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-2444s1c1
Sequence:CCGGGCAGAATCACTCAGCTCCATACTCGAGTATGGAGCTGAGTGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-338s1c1
Sequence:CCGGCGATCCCATTTCCAACGAGTTCTCGAGAACTCGTTGGAAATGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008420
CDH12 MISSION shRNA shRNA Plasmid DNA
cadherin 12, type 2 (N-cadherin 2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-846s1c1
Sequence:CCGGCAGGTGTCATTAGAACAGCATCTCGAGATGCTGTTCTAATGACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008420.1-5244s1c1
Sequence:CCGGCCAGTATTTCAATGCCTGTAACTCGAGTTACAGGCATTGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-1765s1c1
Sequence:CCGGGCAGCAATTCTCCTTTAGATTCTCGAGAATCTAAAGGAGAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-2444s1c1
Sequence:CCGGGCAGAATCACTCAGCTCCATACTCGAGTATGGAGCTGAGTGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-338s1c1
Sequence:CCGGCGATCCCATTTCCAACGAGTTCTCGAGAACTCGTTGGAAATGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008420
CDH12 MISSION shRNA Lentiviral Transduction Particles
cadherin 12, type 2 (N-cadherin 2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-846s1c1
Sequence:CCGGCAGGTGTCATTAGAACAGCATCTCGAGATGCTGTTCTAATGACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008420.1-5244s1c1
Sequence:CCGGCCAGTATTTCAATGCCTGTAACTCGAGTTACAGGCATTGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-1765s1c1
Sequence:CCGGGCAGCAATTCTCCTTTAGATTCTCGAGAATCTAAAGGAGAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-2444s1c1
Sequence:CCGGGCAGAATCACTCAGCTCCATACTCGAGTATGGAGCTGAGTGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008420.1-338s1c1
Sequence:CCGGCGATCCCATTTCCAACGAGTTCTCGAGAACTCGTTGGAAATGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004061
CDH12 MISSION shRNA Bacterial Glycerol Stock
cadherin 12, type 2 (N-cadherin 2)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-1223s1c1
Sequence:CCGGCGGTCACATTTCCAACGTGTTCTCGAGAACACGTTGGAAATGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-3422s1c1
Sequence:CCGGGCAGACATGTTTGGCGAAGAACTCGAGTTCTTCGCCAAACATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-2763s1c1
Sequence:CCGGGCAGGCAGCAAGAGTTGTATTCTCGAGAATACAACTCTTGCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-2444s1c1
Sequence:CCGGGCGCAGTATAATTTCTCCATACTCGAGTATGGAGAAATTATACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-2645s1c1
Sequence:CCGGGCTGGGCAACAATTCTCCTTTCTCGAGAAAGGAGAATTGTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004061.3-3787s21c1
Sequence:CCGGGACAACCTAGAACGAAGATAGCTCGAGCTATCTTCGTTCTAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004061.3-2249s21c1
Sequence:CCGGCTCTACACCATGGAGGTTTATCTCGAGATAAACCTCCATGGTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004061
CDH12 MISSION shRNA shRNA Plasmid DNA
cadherin 12, type 2 (N-cadherin 2)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-1223s1c1
Sequence:CCGGCGGTCACATTTCCAACGTGTTCTCGAGAACACGTTGGAAATGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-3422s1c1
Sequence:CCGGGCAGACATGTTTGGCGAAGAACTCGAGTTCTTCGCCAAACATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-2763s1c1
Sequence:CCGGGCAGGCAGCAAGAGTTGTATTCTCGAGAATACAACTCTTGCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-2444s1c1
Sequence:CCGGGCGCAGTATAATTTCTCCATACTCGAGTATGGAGAAATTATACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-2645s1c1
Sequence:CCGGGCTGGGCAACAATTCTCCTTTCTCGAGAAAGGAGAATTGTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004061.3-3787s21c1
Sequence:CCGGGACAACCTAGAACGAAGATAGCTCGAGCTATCTTCGTTCTAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004061.3-2249s21c1
Sequence:CCGGCTCTACACCATGGAGGTTTATCTCGAGATAAACCTCCATGGTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004061
CDH12 MISSION shRNA Lentiviral Transduction Particles
cadherin 12, type 2 (N-cadherin 2)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-1223s1c1
Sequence:CCGGCGGTCACATTTCCAACGTGTTCTCGAGAACACGTTGGAAATGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-3422s1c1
Sequence:CCGGGCAGACATGTTTGGCGAAGAACTCGAGTTCTTCGCCAAACATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-2763s1c1
Sequence:CCGGGCAGGCAGCAAGAGTTGTATTCTCGAGAATACAACTCTTGCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-2444s1c1
Sequence:CCGGGCGCAGTATAATTTCTCCATACTCGAGTATGGAGAAATTATACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004061.2-2645s1c1
Sequence:CCGGGCTGGGCAACAATTCTCCTTTCTCGAGAAAGGAGAATTGTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004061.3-3787s21c1
Sequence:CCGGGACAACCTAGAACGAAGATAGCTCGAGCTATCTTCGTTCTAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004061.3-2249s21c1
Sequence:CCGGCTCTACACCATGGAGGTTTATCTCGAGATAAACCTCCATGGTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks