EMAIL THIS PAGE TO A FRIEND

CDH13

cadherin 13

144 Gene Product Result for
Synonyms: CDHH P105
UniProtKB ID: P55290, A8W476, A8W477, J3KN62, Q6GTW4, Q8TBX3
Gene ID:
Human(1012) Summary: This gene encodes a member of the cadherin superfamily. The encoded protein is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. The protein lacks the cytoplasmic domain characteristic of other cadherins, and so is not thought to be a cell-cell adhesion glycoprotein. This protein acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. The gene is hypermethylated in many types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2011]
Mouse(12554) cadherin 13
Rat(192248) cadherin 13
Zebrafish(558732) cadherin 13, H-cadherin (heart)
dog(489689) cadherin 13, H-cadherin (heart)
domestic cat(101086108) cadherin 13, H-cadherin (heart)
cow(512302) cadherin 13, H-cadherin (heart)
Horse(100055760) cadherin 13, H-cadherin (heart)
chicken(414849) cadherin 13, H-cadherin (heart)
domestic guinea pig(100731514) cadherin 13, H-cadherin (heart)
naked mole-rat(101713905) cadherin 13, H-cadherin (heart)
sheep(101123062) cadherin 13, H-cadherin (heart)
Domestic Rabbit(100337974) cadherin 13, H-cadherin (heart)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001257 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025411 MISSION® esiRNA esiRNA human CDH13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001257 Rosetta Predictions human pricing
NM_138889 Rosetta Predictions rat pricing
NM_019707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145298 predicted 1033
2 SASI_Hs01_00145299 predicted 652
3 SASI_Hs01_00145300 predicted 963
4 SASI_Hs01_00145301 predicted 1246
5 SASI_Hs02_00331441 predicted 529
6 SASI_Hs01_00145302 predicted 309
7 SASI_Hs01_00145303 predicted 1776
8 SASI_Hs01_00145305 predicted 211
9 SASI_Hs01_00145306 predicted 1012
10 SASI_Hs01_00145307 predicted 725
11 SASI_Hs01_00145304 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041417 predicted 1600
2 SASI_Rn01_00041418 predicted 689
3 SASI_Rn02_00268327 predicted 259
4 SASI_Rn01_00041419 predicted 2020
5 SASI_Rn01_00041420 predicted 949
6 SASI_Rn01_00041421 predicted 308
7 SASI_Rn01_00041422 predicted 679
8 SASI_Rn01_00041424 predicted 1401
9 SASI_Rn01_00041425 predicted 618
10 SASI_Rn02_00268328 predicted 611
11 SASI_Rn01_00041423 predicted 686
12 SASI_Rn01_00041426 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324814 predicted 1812
2 SASI_Mm02_00324815 predicted 1188
3 SASI_Mm01_00113056 predicted 723
4 SASI_Mm01_00113057 predicted 1627
5 SASI_Mm01_00113058 predicted 706
6 SASI_Mm01_00113059 predicted 977
7 SASI_Mm02_00324816 predicted 1622
8 SASI_Mm02_00324817 predicted 823
9 SASI_Mm02_00324818 predicted 1807
10 SASI_Mm01_00113060 predicted 1094
11 SASI_Mm01_00113055 predicted 644
12 SASI_Mm01_00113061 predicted 976
13 SASI_Mm01_00113062 predicted 1440
14 SASI_Mm01_00113063 predicted 924
15 SASI_Mm01_00113064 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001257
VALIDATED
CDH13 MISSION shRNA Bacterial Glycerol Stock
cadherin 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-732s21c1
Sequence:CCGGCAGAGAAGTAATCGCTGTTTACTCGAGTAAACAGCGATTACTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-216s21c1
Sequence:CCGGGCAGAAAGTGTTCCATATCAACTCGAGTTGATATGGAACACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-1389s21c1
Sequence:CCGGGCTTTCTGTTGTCAAACCATTCTCGAGAATGGTTTGACAACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-586s21c1
Sequence:CCGGCCAAGAGATGTTGGCAAGGTACTCGAGTACCTTGCCAACATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001257.2-1957s1c1
Sequence:CCGGCCGAATACAGATCCTTTCAAACTCGAGTTTGAAAGGATCTGTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001257.2-732s1c1
Sequence:CCGGCAGAGAAGTAATCGCTGTTTACTCGAGTAAACAGCGATTACTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001257.2-586s1c1
Sequence:CCGGCCAAGAGATGTTGGCAAGGTACTCGAGTACCTTGCCAACATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001257.2-1389s1c1
Sequence:CCGGGCTTTCTGTTGTCAAACCATTCTCGAGAATGGTTTGACAACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001257.2-216s1c1
Sequence:CCGGGCAGAAAGTGTTCCATATCAACTCGAGTTGATATGGAACACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001257
VALIDATED
CDH13 MISSION shRNA shRNA Plasmid DNA
cadherin 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-732s21c1
Sequence:CCGGCAGAGAAGTAATCGCTGTTTACTCGAGTAAACAGCGATTACTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-216s21c1
Sequence:CCGGGCAGAAAGTGTTCCATATCAACTCGAGTTGATATGGAACACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-1389s21c1
Sequence:CCGGGCTTTCTGTTGTCAAACCATTCTCGAGAATGGTTTGACAACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-586s21c1
Sequence:CCGGCCAAGAGATGTTGGCAAGGTACTCGAGTACCTTGCCAACATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001257.2-1957s1c1
Sequence:CCGGCCGAATACAGATCCTTTCAAACTCGAGTTTGAAAGGATCTGTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001257.2-732s1c1
Sequence:CCGGCAGAGAAGTAATCGCTGTTTACTCGAGTAAACAGCGATTACTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001257.2-586s1c1
Sequence:CCGGCCAAGAGATGTTGGCAAGGTACTCGAGTACCTTGCCAACATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001257.2-1389s1c1
Sequence:CCGGGCTTTCTGTTGTCAAACCATTCTCGAGAATGGTTTGACAACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001257.2-216s1c1
Sequence:CCGGGCAGAAAGTGTTCCATATCAACTCGAGTTGATATGGAACACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001257
VALIDATED
CDH13 MISSION shRNA Lentiviral Transduction Particles
cadherin 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-732s21c1
Sequence:CCGGCAGAGAAGTAATCGCTGTTTACTCGAGTAAACAGCGATTACTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-216s21c1
Sequence:CCGGGCAGAAAGTGTTCCATATCAACTCGAGTTGATATGGAACACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-1389s21c1
Sequence:CCGGGCTTTCTGTTGTCAAACCATTCTCGAGAATGGTTTGACAACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001257.3-586s21c1
Sequence:CCGGCCAAGAGATGTTGGCAAGGTACTCGAGTACCTTGCCAACATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001257.2-1957s1c1
Sequence:CCGGCCGAATACAGATCCTTTCAAACTCGAGTTTGAAAGGATCTGTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001257.2-732s1c1
Sequence:CCGGCAGAGAAGTAATCGCTGTTTACTCGAGTAAACAGCGATTACTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001257.2-586s1c1
Sequence:CCGGCCAAGAGATGTTGGCAAGGTACTCGAGTACCTTGCCAACATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001257.2-1389s1c1
Sequence:CCGGGCTTTCTGTTGTCAAACCATTCTCGAGAATGGTTTGACAACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001257.2-216s1c1
Sequence:CCGGGCAGAAAGTGTTCCATATCAACTCGAGTTGATATGGAACACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019707
VALIDATED
CDH13 MISSION shRNA Bacterial Glycerol Stock
cadherin 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-1958s1c1
Sequence:CCGGCCTTCAAGTTTGAGATTCATACTCGAGTATGAATCTCAAACTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-252s1c1
Sequence:CCGGGCCTGTCCTAAACTTGACCTTCTCGAGAAGGTCAAGTTTAGGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-201s1c1
Sequence:CCGGCCAGCGGAAAGTGTTACACATCTCGAGATGTGTAACACTTTCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-1300s1c1
Sequence:CCGGGCTGCATACACCATCATCAATCTCGAGATTGATGATGGTGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019707.1-1629s1c1
Sequence:CCGGGCAACATCAAACTATCAGGTACTCGAGTACCTGATAGTTTGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019707
VALIDATED
CDH13 MISSION shRNA shRNA Plasmid DNA
cadherin 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-1958s1c1
Sequence:CCGGCCTTCAAGTTTGAGATTCATACTCGAGTATGAATCTCAAACTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-252s1c1
Sequence:CCGGGCCTGTCCTAAACTTGACCTTCTCGAGAAGGTCAAGTTTAGGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-201s1c1
Sequence:CCGGCCAGCGGAAAGTGTTACACATCTCGAGATGTGTAACACTTTCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-1300s1c1
Sequence:CCGGGCTGCATACACCATCATCAATCTCGAGATTGATGATGGTGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019707.1-1629s1c1
Sequence:CCGGGCAACATCAAACTATCAGGTACTCGAGTACCTGATAGTTTGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019707
VALIDATED
CDH13 MISSION shRNA Lentiviral Transduction Particles
cadherin 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-1958s1c1
Sequence:CCGGCCTTCAAGTTTGAGATTCATACTCGAGTATGAATCTCAAACTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-252s1c1
Sequence:CCGGGCCTGTCCTAAACTTGACCTTCTCGAGAAGGTCAAGTTTAGGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-201s1c1
Sequence:CCGGCCAGCGGAAAGTGTTACACATCTCGAGATGTGTAACACTTTCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019707.1-1300s1c1
Sequence:CCGGGCTGCATACACCATCATCAATCTCGAGATTGATGATGGTGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019707.1-1629s1c1
Sequence:CCGGGCAACATCAAACTATCAGGTACTCGAGTACCTGATAGTTTGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks