EMAIL THIS PAGE TO A FRIEND

CDH15

cadherin 15, type 1, M-cadherin (myotubule)

Synonyms: CDH14 CDH3 CDHM MCAD MRD3
UniProtKB ID: P55291
Gene ID:
Human(1013) Summary: This gene is a member of the cadherin superfamily of genes, encoding calcium-dependent intercellular adhesion glycoproteins. Cadherins consist of an extracellular domain containing 5 cadherin domains, a transmembrane region, and a conserved cytoplasmic domain. Transcripts from this particular cadherin are expressed in myoblasts and upregulated in myotubule-forming cells. The protein is thought to be essential for the control of morphogenetic processes, specifically myogenesis, and may provide a trigger for terminal muscle cell differentiation. [provided by RefSeq, Jul 2008]
Mouse(12555) cadherin 15
Rat(361432) cadherin 15
domestic guinea pig(100729850) cadherin 15, type 1, M-cadherin (myotubule)
naked mole-rat(101707671) cadherin 15, type 1, M-cadherin (myotubule)
sheep(101109639) cadherin 15, type 1, M-cadherin (myotubule)
Domestic Rabbit(100356285) cadherin 15, type 1, M-cadherin (myotubule)
Zebrafish(565617) cadherin 15, M-cadherin (myotubule)
dog(479613) cadherin 15, type 1, M-cadherin (myotubule)
domestic cat(101092476) cadherin 15, type 1, M-cadherin (myotubule)
cow(522202) cadherin 15, type 1, M-cadherin (myotubule)
Horse(100066779) cadherin 15, type 1, M-cadherin (myotubule)
Gene Class: Calcium_Binding
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004933 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014251 MISSION® esiRNA esiRNA targeting mouse Cdh15 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004933 Rosetta Predictions human pricing
NM_207613 Rosetta Predictions rat pricing
NM_007662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068629 predicted 948
2 SASI_Hs01_00068630 predicted 406
3 SASI_Hs01_00068631 predicted 2230
4 SASI_Hs01_00068632 predicted 858
5 SASI_Hs01_00068633 predicted 421
6 SASI_Hs01_00068634 predicted 1034
7 SASI_Hs01_00068635 predicted 1194
8 SASI_Hs01_00068636 predicted 2194
9 SASI_Hs01_00068637 predicted 2258
10 SASI_Hs01_00068638 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092982 predicted 1412
2 SASI_Rn01_00092983 predicted 601
3 SASI_Rn01_00092984 predicted 744
4 SASI_Rn01_00092985 predicted 1721
5 SASI_Rn01_00092986 predicted 2444
6 SASI_Rn02_00270446 predicted 206
7 SASI_Rn01_00092988 predicted 1298
8 SASI_Rn01_00092989 predicted 338
9 SASI_Rn02_00270447 predicted 2343
10 SASI_Rn01_00092990 predicted 282
11 SASI_Rn01_00092987 predicted 458
12 SASI_Rn01_00092991 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312165 predicted 1208
2 SASI_Mm02_00312166 predicted 256
3 SASI_Mm01_00049743 predicted 523
4 SASI_Mm01_00049744 predicted 2542
5 SASI_Mm01_00049746 predicted 2056
6 SASI_Mm01_00049747 predicted 1319
7 SASI_Mm01_00049748 predicted 2234
8 SASI_Mm02_00312167 predicted 382
9 SASI_Mm02_00312168 predicted 1324
10 SASI_Mm01_00049751 predicted 2448
11 SASI_Mm01_00049745 predicted 797
12 SASI_Mm01_00049749 predicted 2953
13 SASI_Mm01_00049750 predicted 2967
14 SASI_Mm01_00049752 predicted 1762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007662
CDH15 MISSION shRNA Bacterial Glycerol Stock
cadherin 15, type 1, M-cadherin (myotubule)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007662.1-2957s1c1
Sequence:CCGGCAGAAATCCTATGAGGGTCAACTCGAGTTGACCCTCATAGGATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-2463s1c1
Sequence:CCGGGACAACATCCTTAACTATGATCTCGAGATCATAGTTAAGGATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-933s1c1
Sequence:CCGGGAGATCGTTGTGGTGGATCAACTCGAGTTGATCCACCACAACGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-1739s1c1
Sequence:CCGGGCAGAGAATCAGCTACTCCAACTCGAGTTGGAGTAGCTGATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-2460s1c1
Sequence:CCGGCGGGACAACATCCTTAACTATCTCGAGATAGTTAAGGATGTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007662
CDH15 MISSION shRNA shRNA Plasmid DNA
cadherin 15, type 1, M-cadherin (myotubule)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007662.1-2957s1c1
Sequence:CCGGCAGAAATCCTATGAGGGTCAACTCGAGTTGACCCTCATAGGATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-2463s1c1
Sequence:CCGGGACAACATCCTTAACTATGATCTCGAGATCATAGTTAAGGATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-933s1c1
Sequence:CCGGGAGATCGTTGTGGTGGATCAACTCGAGTTGATCCACCACAACGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-1739s1c1
Sequence:CCGGGCAGAGAATCAGCTACTCCAACTCGAGTTGGAGTAGCTGATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-2460s1c1
Sequence:CCGGCGGGACAACATCCTTAACTATCTCGAGATAGTTAAGGATGTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007662
CDH15 MISSION shRNA Lentiviral Transduction Particles
cadherin 15, type 1, M-cadherin (myotubule)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007662.1-2957s1c1
Sequence:CCGGCAGAAATCCTATGAGGGTCAACTCGAGTTGACCCTCATAGGATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-2463s1c1
Sequence:CCGGGACAACATCCTTAACTATGATCTCGAGATCATAGTTAAGGATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-933s1c1
Sequence:CCGGGAGATCGTTGTGGTGGATCAACTCGAGTTGATCCACCACAACGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-1739s1c1
Sequence:CCGGGCAGAGAATCAGCTACTCCAACTCGAGTTGGAGTAGCTGATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007662.1-2460s1c1
Sequence:CCGGCGGGACAACATCCTTAACTATCTCGAGATAGTTAAGGATGTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004933
CDH15 MISSION shRNA Bacterial Glycerol Stock
cadherin 15, type 1, M-cadherin (myotubule)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-1073s1c1
Sequence:CCGGCTGTGAACACTACGAACTCAACTCGAGTTGAGTTCGTAGTGTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-410s1c1
Sequence:CCGGCCGCGAGAAGACTGATCGCTTCTCGAGAAGCGATCAGTCTTCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-2015s1c1
Sequence:CCGGCCTTCGAGACAATGTCCTCAACTCGAGTTGAGGACATTGTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-116s1c1
Sequence:CCGGCCAGAGCCTCTGCCTGTCTTTCTCGAGAAAGACAGGCAGAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-2213s1c1
Sequence:CCGGCGACTTCATCAATGATGGCTTCTCGAGAAGCCATCATTGATGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-234s21c1
Sequence:CCGGAGCGTATCCGAGAACCACAAGCTCGAGCTTGTGGTTCTCGGATACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-1032s21c1
Sequence:CCAGGAGGGTGTTCTGTCCATTGTGCTCGAGCACAATGGACAGAACACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-868s21c1
Sequence:CCGGAGTTCTTCATGGAGGCCATAGCTCGAGCTATGGCCTCCATGAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-355s21c1
Sequence:CCGGGCGTCTTCTCTATCGACAAGTCTCGAGACTTGTCGATAGAGAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004933
CDH15 MISSION shRNA shRNA Plasmid DNA
cadherin 15, type 1, M-cadherin (myotubule)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-1073s1c1
Sequence:CCGGCTGTGAACACTACGAACTCAACTCGAGTTGAGTTCGTAGTGTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-410s1c1
Sequence:CCGGCCGCGAGAAGACTGATCGCTTCTCGAGAAGCGATCAGTCTTCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-2015s1c1
Sequence:CCGGCCTTCGAGACAATGTCCTCAACTCGAGTTGAGGACATTGTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-116s1c1
Sequence:CCGGCCAGAGCCTCTGCCTGTCTTTCTCGAGAAAGACAGGCAGAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-2213s1c1
Sequence:CCGGCGACTTCATCAATGATGGCTTCTCGAGAAGCCATCATTGATGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-234s21c1
Sequence:CCGGAGCGTATCCGAGAACCACAAGCTCGAGCTTGTGGTTCTCGGATACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-1032s21c1
Sequence:CCAGGAGGGTGTTCTGTCCATTGTGCTCGAGCACAATGGACAGAACACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-868s21c1
Sequence:CCGGAGTTCTTCATGGAGGCCATAGCTCGAGCTATGGCCTCCATGAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-355s21c1
Sequence:CCGGGCGTCTTCTCTATCGACAAGTCTCGAGACTTGTCGATAGAGAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004933
CDH15 MISSION shRNA Lentiviral Transduction Particles
cadherin 15, type 1, M-cadherin (myotubule)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-1073s1c1
Sequence:CCGGCTGTGAACACTACGAACTCAACTCGAGTTGAGTTCGTAGTGTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-410s1c1
Sequence:CCGGCCGCGAGAAGACTGATCGCTTCTCGAGAAGCGATCAGTCTTCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-2015s1c1
Sequence:CCGGCCTTCGAGACAATGTCCTCAACTCGAGTTGAGGACATTGTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-116s1c1
Sequence:CCGGCCAGAGCCTCTGCCTGTCTTTCTCGAGAAAGACAGGCAGAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004933.2-2213s1c1
Sequence:CCGGCGACTTCATCAATGATGGCTTCTCGAGAAGCCATCATTGATGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-234s21c1
Sequence:CCGGAGCGTATCCGAGAACCACAAGCTCGAGCTTGTGGTTCTCGGATACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-1032s21c1
Sequence:CCAGGAGGGTGTTCTGTCCATTGTGCTCGAGCACAATGGACAGAACACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-868s21c1
Sequence:CCGGAGTTCTTCATGGAGGCCATAGCTCGAGCTATGGCCTCCATGAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004933.2-355s21c1
Sequence:CCGGGCGTCTTCTCTATCGACAAGTCTCGAGACTTGTCGATAGAGAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks