EMAIL THIS PAGE TO A FRIEND

CDH16

cadherin 16, KSP-cadherin

64 Gene Product Result for
UniProtKB ID: O75309, B4DPA8, H3BPD3, Q6UW93
Gene ID:
Human(1014) Summary: This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Mouse(12556) cadherin 16
Rat(307614) cadherin 16
domestic cat(101095784) cadherin 16, KSP-cadherin
dog(489770) cadherin 16, KSP-cadherin
Horse(100052822) cadherin 16, KSP-cadherin
cow(508777) cadherin 16, KSP-cadherin
sheep(101109203) cadherin 16, KSP-cadherin
Domestic Rabbit(100328594) cadherin 16, KSP-cadherin
naked mole-rat(101697697) cadherin 16, KSP-cadherin
domestic guinea pig(100714956) cadherin 16, KSP-cadherin
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004062 Rosetta Predictions human pricing
NM_001012055 Rosetta Predictions rat pricing
XM_574190 Rosetta Predictions rat pricing
NM_007663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336845 predicted 792
2 SASI_Hs01_00244694 predicted 824
3 SASI_Hs01_00244695 predicted 272
4 SASI_Hs02_00336846 predicted 275
5 SASI_Hs01_00244697 predicted 1123
6 SASI_Hs01_00244699 predicted 1365
7 SASI_Hs01_00244700 predicted 1626
8 SASI_Hs01_00244701 predicted 338
9 SASI_Hs01_00244702 predicted 1588
10 SASI_Hs01_00244703 predicted 1613
11 SASI_Hs01_00244696 predicted 912
12 SASI_Hs01_00244698 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066238 predicted 761
2 SASI_Rn01_00066239 predicted 631
3 SASI_Rn01_00066240 predicted 1440
4 SASI_Rn01_00066241 predicted 1064
5 SASI_Rn01_00066242 predicted 979
6 SASI_Rn01_00066243 predicted 1501
7 SASI_Rn01_00066244 predicted 621
8 SASI_Rn01_00066245 predicted 286
9 SASI_Rn01_00066246 predicted 1592
10 SASI_Rn02_00200161 predicted 768
11 SASI_Rn01_00066237 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170865 predicted 344
2 SASI_Rn01_00170866 predicted 1255
3 SASI_Rn01_00170867 predicted 1439
4 SASI_Rn01_00170868 predicted 1506
5 SASI_Rn01_00170869 predicted 298
6 SASI_Rn01_00170870 predicted 1593
7 SASI_Rn01_00170871 predicted 1708
8 SASI_Rn01_00170872 predicted 1259
9 SASI_Rn01_00170873 predicted 1167
10 SASI_Rn01_00170874 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089146 predicted 1676
2 SASI_Mm01_00089147 predicted 1047
3 SASI_Mm01_00089148 predicted 879
4 SASI_Mm01_00089149 predicted 1581
5 SASI_Mm01_00089150 predicted 2340
6 SASI_Mm01_00089151 predicted 1139
7 SASI_Mm01_00089152 predicted 1436
8 SASI_Mm01_00089153 predicted 805
9 SASI_Mm01_00089154 predicted 270
10 SASI_Mm01_00089155 predicted 1680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004062
CDH16 MISSION shRNA Bacterial Glycerol Stock
cadherin 16, KSP-cadherin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004062.2-1002s21c1
Sequence:CCGGATTCCCATGGCGAGGACTATGCTCGAGCATAGTCCTCGCCATGGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004062.2-1179s21c1
Sequence:CCGGCCAATTCCCACGTTGTGTATCCTCGAGGATACACAACGTGGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004062.2-1383s21c1
Sequence:CCGGTCGCAGTCACAGATATCAATGCTCGAGCATTGATATCTGTGACTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-812s1c1
Sequence:CCGGGCAGAGAATCTCAAAGTCCTACTCGAGTAGGACTTTGAGATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-1613s1c1
Sequence:CCGGCTCTGCAAGAACCTCAGTTATCTCGAGATAACTGAGGTTCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-184s1c1
Sequence:CCGGCCCTTTATACCTGACCAAGTTCTCGAGAACTTGGTCAGGTATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-2026s1c1
Sequence:CCGGCCTGGTGATCCACTTCCTAAACTCGAGTTTAGGAAGTGGATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-2452s1c1
Sequence:CCGGCCTGGTAGCAATAGGAATCTTCTCGAGAAGATTCCTATTGCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004062
CDH16 MISSION shRNA shRNA Plasmid DNA
cadherin 16, KSP-cadherin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004062.2-1002s21c1
Sequence:CCGGATTCCCATGGCGAGGACTATGCTCGAGCATAGTCCTCGCCATGGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004062.2-1179s21c1
Sequence:CCGGCCAATTCCCACGTTGTGTATCCTCGAGGATACACAACGTGGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004062.2-1383s21c1
Sequence:CCGGTCGCAGTCACAGATATCAATGCTCGAGCATTGATATCTGTGACTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-812s1c1
Sequence:CCGGGCAGAGAATCTCAAAGTCCTACTCGAGTAGGACTTTGAGATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-1613s1c1
Sequence:CCGGCTCTGCAAGAACCTCAGTTATCTCGAGATAACTGAGGTTCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-184s1c1
Sequence:CCGGCCCTTTATACCTGACCAAGTTCTCGAGAACTTGGTCAGGTATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-2026s1c1
Sequence:CCGGCCTGGTGATCCACTTCCTAAACTCGAGTTTAGGAAGTGGATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-2452s1c1
Sequence:CCGGCCTGGTAGCAATAGGAATCTTCTCGAGAAGATTCCTATTGCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004062
CDH16 MISSION shRNA Lentiviral Transduction Particles
cadherin 16, KSP-cadherin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004062.2-1002s21c1
Sequence:CCGGATTCCCATGGCGAGGACTATGCTCGAGCATAGTCCTCGCCATGGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004062.2-1179s21c1
Sequence:CCGGCCAATTCCCACGTTGTGTATCCTCGAGGATACACAACGTGGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004062.2-1383s21c1
Sequence:CCGGTCGCAGTCACAGATATCAATGCTCGAGCATTGATATCTGTGACTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-812s1c1
Sequence:CCGGGCAGAGAATCTCAAAGTCCTACTCGAGTAGGACTTTGAGATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-1613s1c1
Sequence:CCGGCTCTGCAAGAACCTCAGTTATCTCGAGATAACTGAGGTTCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-184s1c1
Sequence:CCGGCCCTTTATACCTGACCAAGTTCTCGAGAACTTGGTCAGGTATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-2026s1c1
Sequence:CCGGCCTGGTGATCCACTTCCTAAACTCGAGTTTAGGAAGTGGATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004062.2-2452s1c1
Sequence:CCGGCCTGGTAGCAATAGGAATCTTCTCGAGAAGATTCCTATTGCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007663
CDH16 MISSION shRNA Bacterial Glycerol Stock
cadherin 16, KSP-cadherin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007663.1-2663s1c1
Sequence:CCGGCCCTCTGAACTCACTGAGAAACTCGAGTTTCTCAGTGAGTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-2522s1c1
Sequence:CCGGGCGATAGGCTTCATTCTCATTCTCGAGAATGAGAATGAAGCCTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-1727s1c1
Sequence:CCGGGTCGTGAGTAACATAGAAGAACTCGAGTTCTTCTATGTTACTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-757s1c1
Sequence:CCGGCCAGCTATTGGTACAGGTCAACTCGAGTTGACCTGTACCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-1249s1c1
Sequence:CCGGCCACATTGTATATCAGTTGTTCTCGAGAACAACTGATATACAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007663
CDH16 MISSION shRNA shRNA Plasmid DNA
cadherin 16, KSP-cadherin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007663.1-2663s1c1
Sequence:CCGGCCCTCTGAACTCACTGAGAAACTCGAGTTTCTCAGTGAGTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-2522s1c1
Sequence:CCGGGCGATAGGCTTCATTCTCATTCTCGAGAATGAGAATGAAGCCTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-1727s1c1
Sequence:CCGGGTCGTGAGTAACATAGAAGAACTCGAGTTCTTCTATGTTACTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-757s1c1
Sequence:CCGGCCAGCTATTGGTACAGGTCAACTCGAGTTGACCTGTACCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-1249s1c1
Sequence:CCGGCCACATTGTATATCAGTTGTTCTCGAGAACAACTGATATACAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007663
CDH16 MISSION shRNA Lentiviral Transduction Particles
cadherin 16, KSP-cadherin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007663.1-2663s1c1
Sequence:CCGGCCCTCTGAACTCACTGAGAAACTCGAGTTTCTCAGTGAGTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-2522s1c1
Sequence:CCGGGCGATAGGCTTCATTCTCATTCTCGAGAATGAGAATGAAGCCTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-1727s1c1
Sequence:CCGGGTCGTGAGTAACATAGAAGAACTCGAGTTCTTCTATGTTACTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-757s1c1
Sequence:CCGGCCAGCTATTGGTACAGGTCAACTCGAGTTGACCTGTACCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007663.1-1249s1c1
Sequence:CCGGCCACATTGTATATCAGTTGTTCTCGAGAACAACTGATATACAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks