EMAIL THIS PAGE TO A FRIEND

CDH17

cadherin 17, LI cadherin (liver-intestine)

97 Gene Product Result for
Synonyms: CDH16 HPT-1 HPT1
UniProtKB ID: Q12864, Q15336, Q2M2E0
Gene ID:
Human(1015) Summary: This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Mouse(12557) cadherin 17
Rat(117048) cadherin 17
domestic guinea pig(100718080) cadherin 17, LI cadherin (liver-intestine)
naked mole-rat(101725799) cadherin 17, LI cadherin (liver-intestine)
sheep(101111295) cadherin 17, LI cadherin (liver-intestine)
Domestic Rabbit(100356103) cadherin 17, LI cadherin (liver-intestine)
Zebrafish(378452) cadherin 17, LI cadherin (liver-intestine)
dog(487050) cadherin 17, LI cadherin (liver-intestine)
cow(507526) cadherin 17, LI cadherin (liver-intestine)
Horse(100051232) cadherin 17, LI cadherin (liver-intestine)
domestic cat(101083236) cadherin 17, LI cadherin (liver-intestine)
chicken(420225) cadherin 17, LI cadherin (liver-intestine)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500021 Anti-Cadherin -17 antibody, Rabbit monoclonal clone SP183, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
GW22817 Anti-CDH17 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA023614 Anti-CDH17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry, western blot pricing
HPA023616 Anti-CDH17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry, western blot pricing
HPA026556 Anti-CDH17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 human
immunohistochemistry, western blot pricing
SAB4500044 Anti-CDH17 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
WH0001015M1 Monoclonal Anti-CDH17 antibody produced in mouse clone 1H3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403654 Monoclonal Anti-CDH17 antibody produced in mouse clone 3H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004063 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004063 Rosetta Predictions human pricing
NM_053977 Rosetta Predictions rat pricing
NM_019753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166354 predicted 1153
2 SASI_Hs01_00166355 predicted 1863
3 SASI_Hs01_00166356 predicted 1075
4 SASI_Hs01_00166357 predicted 1312
5 SASI_Hs01_00166358 predicted 1379
6 SASI_Hs01_00166359 predicted 534
7 SASI_Hs02_00336847 predicted 786
8 SASI_Hs02_00336848 predicted 307
9 SASI_Hs01_00166361 predicted 1350
10 SASI_Hs01_00166362 predicted 1474
11 SASI_Hs01_00166360 predicted 1801
12 SASI_Hs01_00166363 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059618 predicted 908
2 SASI_Rn01_00059619 predicted 1345
3 SASI_Rn01_00059620 predicted 1912
4 SASI_Rn01_00059621 predicted 2359
5 SASI_Rn01_00059622 predicted 1979
6 SASI_Rn01_00059623 predicted 755
7 SASI_Rn01_00059624 predicted 1157
8 SASI_Rn01_00059626 predicted 1065
9 SASI_Rn01_00059627 predicted 2476
10 SASI_Rn02_00266964 predicted 1637
11 SASI_Rn01_00059625 predicted 2073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159771 predicted 2715
2 SASI_Mm02_00324916 predicted 662
3 SASI_Mm02_00324917 predicted 1207
4 SASI_Mm01_00159772 predicted 1222
5 SASI_Mm01_00159773 predicted 2708
6 SASI_Mm02_00324918 predicted 819
7 SASI_Mm01_00159776 predicted 2335
8 SASI_Mm01_00159777 predicted 274
9 SASI_Mm01_00159778 predicted 2022
10 SASI_Mm01_00159779 predicted 310
11 SASI_Mm01_00159774 predicted 1448
12 SASI_Mm01_00159775 predicted 1048
13 SASI_Mm01_00159780 predicted 2372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019753
VALIDATED
CDH17 MISSION shRNA Bacterial Glycerol Stock
cadherin 17, LI cadherin (liver-intestine)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-277s1c1
Sequence:CCGGCGGGAGAGACAGATGGTATATCTCGAGATATACCATCTGTCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-2951s1c1
Sequence:CCGGGCTGTTATCTATCACCAAATTCTCGAGAATTTGGTGATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-1617s1c1
Sequence:CCGGGCAGGATATGTCAAGATCAAACTCGAGTTTGATCTTGACATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019753.2-1790s1c1
Sequence:CCGGCCAGCGAATATTCCAAGCAAACTCGAGTTTGCTTGGAATATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-1197s1c1
Sequence:CCGGGCTAACAACATCAACAGTATTCTCGAGAATACTGTTGATGTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019753.4-3001s21c1
Sequence:CCGGGCTGTTATCTATCACCAAATTCTCGAGAATTTGGTGATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019753.4-1672s21c1
Sequence:CCGGGCAGGATATGTCAAGATCAAACTCGAGTTTGATCTTGACATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019753.4-332s21c1
Sequence:CCGGCGGGAGAGACAGATGGTATATCTCGAGATATACCATCTGTCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019753.4-1252s21c1
Sequence:CCGGGCTAACAACATCAACAGTATTCTCGAGAATACTGTTGATGTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019753
VALIDATED
CDH17 MISSION shRNA shRNA Plasmid DNA
cadherin 17, LI cadherin (liver-intestine)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-277s1c1
Sequence:CCGGCGGGAGAGACAGATGGTATATCTCGAGATATACCATCTGTCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-2951s1c1
Sequence:CCGGGCTGTTATCTATCACCAAATTCTCGAGAATTTGGTGATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-1617s1c1
Sequence:CCGGGCAGGATATGTCAAGATCAAACTCGAGTTTGATCTTGACATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019753.2-1790s1c1
Sequence:CCGGCCAGCGAATATTCCAAGCAAACTCGAGTTTGCTTGGAATATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-1197s1c1
Sequence:CCGGGCTAACAACATCAACAGTATTCTCGAGAATACTGTTGATGTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019753.4-3001s21c1
Sequence:CCGGGCTGTTATCTATCACCAAATTCTCGAGAATTTGGTGATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019753.4-1672s21c1
Sequence:CCGGGCAGGATATGTCAAGATCAAACTCGAGTTTGATCTTGACATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019753.4-332s21c1
Sequence:CCGGCGGGAGAGACAGATGGTATATCTCGAGATATACCATCTGTCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019753.4-1252s21c1
Sequence:CCGGGCTAACAACATCAACAGTATTCTCGAGAATACTGTTGATGTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019753
VALIDATED
CDH17 MISSION shRNA Lentiviral Transduction Particles
cadherin 17, LI cadherin (liver-intestine)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-277s1c1
Sequence:CCGGCGGGAGAGACAGATGGTATATCTCGAGATATACCATCTGTCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-2951s1c1
Sequence:CCGGGCTGTTATCTATCACCAAATTCTCGAGAATTTGGTGATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-1617s1c1
Sequence:CCGGGCAGGATATGTCAAGATCAAACTCGAGTTTGATCTTGACATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019753.2-1790s1c1
Sequence:CCGGCCAGCGAATATTCCAAGCAAACTCGAGTTTGCTTGGAATATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019753.2-1197s1c1
Sequence:CCGGGCTAACAACATCAACAGTATTCTCGAGAATACTGTTGATGTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019753.4-3001s21c1
Sequence:CCGGGCTGTTATCTATCACCAAATTCTCGAGAATTTGGTGATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019753.4-1672s21c1
Sequence:CCGGGCAGGATATGTCAAGATCAAACTCGAGTTTGATCTTGACATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019753.4-332s21c1
Sequence:CCGGCGGGAGAGACAGATGGTATATCTCGAGATATACCATCTGTCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019753.4-1252s21c1
Sequence:CCGGGCTAACAACATCAACAGTATTCTCGAGAATACTGTTGATGTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004063
VALIDATED
CDH17 MISSION shRNA Bacterial Glycerol Stock
cadherin 17, LI cadherin (liver-intestine)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-2387s1c1
Sequence:CCGGGCATTGTTTCTTTACCAGTTACTCGAGTAACTGGTAAAGAAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-2082s1c1
Sequence:CCGGCCTGATCCTTATGGATGTGAACTCGAGTTCACATCCATAAGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-445s1c1
Sequence:CCGGCCAGTCCCTATCACCATAGAACTCGAGTTCTATGGTGATAGGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004063.2-1075s1c1
Sequence:CCGGCCACTTTCATATCCGCTGGAACTCGAGTTCCAGCGGATATGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-2530s1c1
Sequence:CCGGGCAGTTGTGTTTATCCGCATACTCGAGTATGCGGATAAACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004063
VALIDATED
CDH17 MISSION shRNA shRNA Plasmid DNA
cadherin 17, LI cadherin (liver-intestine)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-2387s1c1
Sequence:CCGGGCATTGTTTCTTTACCAGTTACTCGAGTAACTGGTAAAGAAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-2082s1c1
Sequence:CCGGCCTGATCCTTATGGATGTGAACTCGAGTTCACATCCATAAGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-445s1c1
Sequence:CCGGCCAGTCCCTATCACCATAGAACTCGAGTTCTATGGTGATAGGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004063.2-1075s1c1
Sequence:CCGGCCACTTTCATATCCGCTGGAACTCGAGTTCCAGCGGATATGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-2530s1c1
Sequence:CCGGGCAGTTGTGTTTATCCGCATACTCGAGTATGCGGATAAACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004063
VALIDATED
CDH17 MISSION shRNA Lentiviral Transduction Particles
cadherin 17, LI cadherin (liver-intestine)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-2387s1c1
Sequence:CCGGGCATTGTTTCTTTACCAGTTACTCGAGTAACTGGTAAAGAAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-2082s1c1
Sequence:CCGGCCTGATCCTTATGGATGTGAACTCGAGTTCACATCCATAAGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-445s1c1
Sequence:CCGGCCAGTCCCTATCACCATAGAACTCGAGTTCTATGGTGATAGGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004063.2-1075s1c1
Sequence:CCGGCCACTTTCATATCCGCTGGAACTCGAGTTCCAGCGGATATGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004063.2-2530s1c1
Sequence:CCGGGCAGTTGTGTTTATCCGCATACTCGAGTATGCGGATAAACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks