EMAIL THIS PAGE TO A FRIEND

CDH18

cadherin 18, type 2

Synonyms: CDH14 CDH14L CDH24
UniProtKB ID: Q13634, A8K0I2, B4DHG6, Q8N5Z2
Gene ID:
Human(1016) Summary: This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. [provided by RefSeq, Jul 2008]
Mouse(320865) cadherin 18
Rat(310174) cadherin 18, type 2
Zebrafish(767768) cadherin 18, type 2
cow(512080) cadherin 18, type 2
domestic cat(101087557) cadherin 18, type 2
dog(489256) cadherin 18, type 2
chicken(428490) cadherin 18, type 2
Domestic Rabbit(100339988) cadherin 18, type 2
naked mole-rat(101707560) cadherin 18, type 2
domestic guinea pig(100721693) cadherin 18, type 2
Gene Class: Calcium_Binding
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004934 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010551 MISSION® esiRNA esiRNA targeting human CDH18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004934 Rosetta Predictions human pricing
NM_001107656 Rosetta Predictions rat pricing
NM_001081299 Rosetta Predictions mouse pricing
XM_001487793 Rosetta Predictions mouse pricing
XM_354862 Rosetta Predictions mouse pricing
XM_888056 Rosetta Predictions mouse pricing
XM_908096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338602 predicted 782
2 SASI_Hs01_00192224 predicted 2647
3 SASI_Hs02_00338603 predicted 2341
4 SASI_Hs01_00192225 predicted 762
5 SASI_Hs01_00192226 predicted 2443
6 SASI_Hs01_00192227 predicted 1718
7 SASI_Hs01_00192228 predicted 1675
8 SASI_Hs01_00192229 predicted 2615
9 SASI_Hs01_00192230 predicted 1771
10 SASI_Hs01_00192231 predicted 1059
11 SASI_Hs01_00192232 predicted 885
12 SASI_Hs01_00192233 predicted 2608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230975 predicted 560
2 SASI_Rn02_00230976 predicted 604
3 SASI_Rn02_00230977 predicted 422
4 SASI_Rn02_00230978 predicted 641
5 SASI_Rn02_00230979 predicted 530
6 SASI_Rn02_00230980 predicted 316
7 SASI_Rn02_00230981 predicted 201
8 SASI_Rn02_00230982 predicted 271
9 SASI_Rn02_00230983 predicted 677
10 SASI_Rn02_00230984 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297091 predicted 1633
2 SASI_Mm02_00297092 predicted 749
3 SASI_Mm02_00297093 predicted 1265
4 SASI_Mm02_00297094 predicted 1423
5 SASI_Mm02_00297095 predicted 1078
6 SASI_Mm02_00297096 predicted 2489
7 SASI_Mm02_00297097 predicted 2337
8 SASI_Mm02_00297098 predicted 2209
9 SASI_Mm02_00297099 predicted 1058
10 SASI_Mm02_00297100 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001487793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423892 predicted 241
2 SASI_Mm02_00423893 predicted 273
3 SASI_Mm02_00423894 predicted 238
4 SASI_Mm02_00423895 predicted 87
5 SASI_Mm02_00423896 predicted 140
6 SASI_Mm02_00423897 predicted 183
7 SASI_Mm02_00423898 predicted 592
8 SASI_Mm02_00423899 predicted 588
9 SASI_Mm02_00423900 predicted 646
10 SASI_Mm02_00423901 predicted 37
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237172 predicted 757
2 SASI_Mm01_00237173 predicted 2059
3 SASI_Mm01_00237174 predicted 1793
4 SASI_Mm01_00237175 predicted 1273
5 SASI_Mm01_00237176 predicted 1422
6 SASI_Mm01_00237177 predicted 2007
7 SASI_Mm01_00237178 predicted 1087
8 SASI_Mm01_00237179 predicted 1978
9 SASI_Mm01_00237180 predicted 1054
10 SASI_Mm01_00237181 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254734 predicted 764
2 SASI_Mm01_00254735 predicted 1798
3 SASI_Mm01_00254736 predicted 1280
4 SASI_Mm01_00254737 predicted 1424
5 SASI_Mm01_00254738 predicted 1087
6 SASI_Mm01_00254739 predicted 2503
7 SASI_Mm01_00254740 predicted 2336
8 SASI_Mm01_00254741 predicted 1060
9 SASI_Mm01_00254742 predicted 882
10 SASI_Mm01_00254743 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433749 predicted 1641
2 SASI_Mm02_00433750 predicted 753
3 SASI_Mm02_00433751 predicted 1267
4 SASI_Mm02_00433752 predicted 1418
5 SASI_Mm02_00433753 predicted 1075
6 SASI_Mm02_00433754 predicted 2495
7 SASI_Mm02_00433755 predicted 2334
8 SASI_Mm02_00433756 predicted 2205
9 SASI_Mm02_00433757 predicted 1051
10 SASI_Mm02_00433758 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004934
VALIDATED
CDH18 MISSION shRNA Bacterial Glycerol Stock
cadherin 18, type 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004934.3-2909s21c1
Sequence:CCGGGGGTCAGTTCTTGCAACCTTGCTCGAGCAAGGTTGCAAGAACTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004934.3-2921s21c1
Sequence:CCGGGCAACCTTGTGGAATTTGCTTCTCGAGAAGCAAATTCCACAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004934.3-1663s21c1
Sequence:CCGGGTAGATGAACCACCACTATTTCTCGAGAAATAGTGGTGGTTCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004934.2-666s1c1
Sequence:CCGGGCTGGGACTATATTTATCATTCTCGAGAATGATAAATATAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004934.2-2647s1c1
Sequence:CCGGCGACACAATCAGACCAGGATTCTCGAGAATCCTGGTCTGATTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004934.2-1409s1c1
Sequence:CCGGCCTCAACATAGAAGGAGCAAACTCGAGTTTGCTCCTTCTATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004934.2-1967s1c1
Sequence:CCGGCCTGCCTGTAAATCCAAACTTCTCGAGAAGTTTGGATTTACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004934.2-1842s1c1
Sequence:CCGGGCCAGGGAATATGATATTATTCTCGAGAATAATATCATATTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004934
VALIDATED
CDH18 MISSION shRNA shRNA Plasmid DNA
cadherin 18, type 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004934.3-2909s21c1
Sequence:CCGGGGGTCAGTTCTTGCAACCTTGCTCGAGCAAGGTTGCAAGAACTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004934.3-2921s21c1
Sequence:CCGGGCAACCTTGTGGAATTTGCTTCTCGAGAAGCAAATTCCACAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004934.3-1663s21c1
Sequence:CCGGGTAGATGAACCACCACTATTTCTCGAGAAATAGTGGTGGTTCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004934.2-666s1c1
Sequence:CCGGGCTGGGACTATATTTATCATTCTCGAGAATGATAAATATAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004934.2-2647s1c1
Sequence:CCGGCGACACAATCAGACCAGGATTCTCGAGAATCCTGGTCTGATTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004934.2-1409s1c1
Sequence:CCGGCCTCAACATAGAAGGAGCAAACTCGAGTTTGCTCCTTCTATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004934.2-1967s1c1
Sequence:CCGGCCTGCCTGTAAATCCAAACTTCTCGAGAAGTTTGGATTTACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004934.2-1842s1c1
Sequence:CCGGGCCAGGGAATATGATATTATTCTCGAGAATAATATCATATTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004934
VALIDATED
CDH18 MISSION shRNA Lentiviral Transduction Particles
cadherin 18, type 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004934.3-2909s21c1
Sequence:CCGGGGGTCAGTTCTTGCAACCTTGCTCGAGCAAGGTTGCAAGAACTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004934.3-2921s21c1
Sequence:CCGGGCAACCTTGTGGAATTTGCTTCTCGAGAAGCAAATTCCACAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004934.3-1663s21c1
Sequence:CCGGGTAGATGAACCACCACTATTTCTCGAGAAATAGTGGTGGTTCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004934.2-666s1c1
Sequence:CCGGGCTGGGACTATATTTATCATTCTCGAGAATGATAAATATAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004934.2-2647s1c1
Sequence:CCGGCGACACAATCAGACCAGGATTCTCGAGAATCCTGGTCTGATTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004934.2-1409s1c1
Sequence:CCGGCCTCAACATAGAAGGAGCAAACTCGAGTTTGCTCCTTCTATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004934.2-1967s1c1
Sequence:CCGGCCTGCCTGTAAATCCAAACTTCTCGAGAAGTTTGGATTTACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004934.2-1842s1c1
Sequence:CCGGGCCAGGGAATATGATATTATTCTCGAGAATAATATCATATTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081299
CDH18 MISSION shRNA Bacterial Glycerol Stock
cadherin 18, type 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-974s21c1
Sequence:CCGGCCTGCAAGGACAACCTTATTTCTCGAGAAATAAGGTTGTCCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-2058s21c1
Sequence:CCGGGTGTATTATCTGCCCATTATGCTCGAGCATAATGGGCAGATAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-759s21c1
Sequence:CCGGGCTATTGACAGACGGACAAACCTCGAGGTTTGTCCGTCTGTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-1674s21c1
Sequence:CCGGGCCAATACTGGAACCATTAAGCTCGAGCTTAATGGTTCCAGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-1780s21c1
Sequence:CCGGGCCATGTCTCCGTGGGTATTACTCGAGTAATACCCACGGAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081299
CDH18 MISSION shRNA shRNA Plasmid DNA
cadherin 18, type 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-974s21c1
Sequence:CCGGCCTGCAAGGACAACCTTATTTCTCGAGAAATAAGGTTGTCCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-2058s21c1
Sequence:CCGGGTGTATTATCTGCCCATTATGCTCGAGCATAATGGGCAGATAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-759s21c1
Sequence:CCGGGCTATTGACAGACGGACAAACCTCGAGGTTTGTCCGTCTGTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-1674s21c1
Sequence:CCGGGCCAATACTGGAACCATTAAGCTCGAGCTTAATGGTTCCAGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-1780s21c1
Sequence:CCGGGCCATGTCTCCGTGGGTATTACTCGAGTAATACCCACGGAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081299
CDH18 MISSION shRNA Lentiviral Transduction Particles
cadherin 18, type 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-974s21c1
Sequence:CCGGCCTGCAAGGACAACCTTATTTCTCGAGAAATAAGGTTGTCCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-2058s21c1
Sequence:CCGGGTGTATTATCTGCCCATTATGCTCGAGCATAATGGGCAGATAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-759s21c1
Sequence:CCGGGCTATTGACAGACGGACAAACCTCGAGGTTTGTCCGTCTGTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-1674s21c1
Sequence:CCGGGCCAATACTGGAACCATTAAGCTCGAGCTTAATGGTTCCAGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081299.1-1780s21c1
Sequence:CCGGGCCATGTCTCCGTGGGTATTACTCGAGTAATACCCACGGAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks