EMAIL THIS PAGE TO A FRIEND

CDH19

cadherin 19, type 2

Synonyms: CDH7 CDH7L2
UniProtKB ID: Q9H159, B4E1V5, F5H1K0
Gene ID:
Human(28513) Summary: This gene is one of three related type II cadherin genes situated in a cluster on chromosome 18. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein containing five extracellular cadherin repeats. Loss of cadherins may be associated with cancer formation. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2012]
Mouse(227485) cadherin 19, type 2
Rat(360835) cadherin 19, type 2
domestic guinea pig(100713911) cadherin 19, type 2
naked mole-rat(101707889) cadherin 19, type 2
sheep(101113295) cadherin 19, type 2
Domestic Rabbit(100341097) cadherin 19, type 2
chicken(421029) cadherin 19, type 2
cow(781265) cadherin 19, type 2
Horse(100058828) cadherin 19, type 2
dog(483948) cadherin 19, type 2
domestic cat(101086604) cadherin 19, type 2
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021153 Rosetta Predictions human pricing
NM_001009448 Rosetta Predictions rat pricing
XM_579286 Rosetta Predictions rat pricing
NM_001081386 Rosetta Predictions mouse pricing
XM_911655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037259 predicted 736
2 SASI_Hs01_00037260 predicted 1631
3 SASI_Hs01_00037261 predicted 1420
4 SASI_Hs01_00037262 predicted 483
5 SASI_Hs01_00037263 predicted 438
6 SASI_Hs01_00037264 predicted 1669
7 SASI_Hs01_00037265 predicted 1779
8 SASI_Hs01_00037266 predicted 1334
9 SASI_Hs02_00354693 predicted 418
10 SASI_Hs01_00037267 predicted 2245
11 SASI_Hs01_00037268 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107986 predicted 1209
2 SASI_Rn01_00107987 predicted 1057
3 SASI_Rn01_00107988 predicted 745
4 SASI_Rn01_00107989 predicted 405
5 SASI_Rn01_00107990 predicted 983
6 SASI_Rn01_00107991 predicted 1806
7 SASI_Rn01_00107992 predicted 1207
8 SASI_Rn01_00107993 predicted 1690
9 SASI_Rn01_00107994 predicted 1270
10 SASI_Rn02_00199545 predicted 714
11 SASI_Rn01_00107985 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179806 predicted 2097
2 SASI_Rn01_00179807 predicted 2072
3 SASI_Rn01_00179808 predicted 2064
4 SASI_Rn01_00179809 predicted 2046
5 SASI_Rn01_00179810 predicted 2068
6 SASI_Rn01_00179811 predicted 2025
7 SASI_Rn01_00179812 predicted 2068
8 SASI_Rn01_00179813 predicted 2080
9 SASI_Rn01_00179814 predicted 2065
10 SASI_Rn01_00179815 predicted 2025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297891 predicted 1286
2 SASI_Mm02_00297892 predicted 974
3 SASI_Mm02_00297893 predicted 1912
4 SASI_Mm02_00297894 predicted 770
5 SASI_Mm02_00297895 predicted 2526
6 SASI_Mm02_00297896 predicted 1718
7 SASI_Mm02_00297897 predicted 655
8 SASI_Mm02_00297898 predicted 1978
9 SASI_Mm02_00297899 predicted 2385
10 SASI_Mm02_00297900 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282777 predicted 1720
2 SASI_Mm01_00282778 predicted 1289
3 SASI_Mm01_00282779 predicted 979
4 SASI_Mm01_00282780 predicted 771
5 SASI_Mm01_00282781 predicted 664
6 SASI_Mm01_00282782 predicted 267
7 SASI_Mm01_00282783 predicted 875
8 SASI_Mm01_00282784 predicted 1350
9 SASI_Mm01_00282785 predicted 835
10 SASI_Mm01_00282786 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021153
VALIDATED
CDH19 MISSION shRNA Bacterial Glycerol Stock
cadherin 19, type 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_021153.2-2932s1c1
Sequence:CCGGCCATGAAGTATTGTTTCCTTTCTCGAGAAAGGAAACAATACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021153.2-1501s1c1
Sequence:CCGGCCACTGTATGTGCAAGTTCTTCTCGAGAAGAACTTGCACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021153.2-666s1c1
Sequence:CCGGCGATCCCTCAAGTGGTAATAACTCGAGTTATTACCACTTGAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021153.2-488s1c1
Sequence:CCGGCCCAGGTAATAGACATCGCTACTCGAGTAGCGATGTCTATTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_021153.2-1809s1c1
Sequence:CCGGCCCGTCACTTACAAGTACAAACTCGAGTTTGTACTTGTAAGTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021153.2-2500s21c1
Sequence:CCGGCGAACCCAATGGTAGTCTTAACTCGAGTTAAGACTACCATTGGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1438s21c1
Sequence:CCGGGCTTGGTACAACCTAAGTATTCTCGAGAATACTTAGGTTGTACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1413s21c1
Sequence:CCGGTAACTCACTGGATCGTGAAATCTCGAGATTTCACGATCCAGTGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1115s21c1
Sequence:CCGGACCAGAACCACTACGGTATTACTCGAGTAATACCGTAGTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1036s21c1
Sequence:CCGGTCGCAAACATTTGACATTATTCTCGAGAATAATGTCAAATGTTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_021153.2-2747s21c1
Sequence:CCGGGTCGATCCTTATGCGATTATACTCGAGTATAATCGCATAAGGATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021153
VALIDATED
CDH19 MISSION shRNA shRNA Plasmid DNA
cadherin 19, type 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_021153.2-2932s1c1
Sequence:CCGGCCATGAAGTATTGTTTCCTTTCTCGAGAAAGGAAACAATACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021153.2-1501s1c1
Sequence:CCGGCCACTGTATGTGCAAGTTCTTCTCGAGAAGAACTTGCACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021153.2-666s1c1
Sequence:CCGGCGATCCCTCAAGTGGTAATAACTCGAGTTATTACCACTTGAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021153.2-488s1c1
Sequence:CCGGCCCAGGTAATAGACATCGCTACTCGAGTAGCGATGTCTATTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_021153.2-1809s1c1
Sequence:CCGGCCCGTCACTTACAAGTACAAACTCGAGTTTGTACTTGTAAGTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021153.2-2500s21c1
Sequence:CCGGCGAACCCAATGGTAGTCTTAACTCGAGTTAAGACTACCATTGGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1438s21c1
Sequence:CCGGGCTTGGTACAACCTAAGTATTCTCGAGAATACTTAGGTTGTACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1413s21c1
Sequence:CCGGTAACTCACTGGATCGTGAAATCTCGAGATTTCACGATCCAGTGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1115s21c1
Sequence:CCGGACCAGAACCACTACGGTATTACTCGAGTAATACCGTAGTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1036s21c1
Sequence:CCGGTCGCAAACATTTGACATTATTCTCGAGAATAATGTCAAATGTTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_021153.2-2747s21c1
Sequence:CCGGGTCGATCCTTATGCGATTATACTCGAGTATAATCGCATAAGGATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021153
VALIDATED
CDH19 MISSION shRNA Lentiviral Transduction Particles
cadherin 19, type 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_021153.2-2932s1c1
Sequence:CCGGCCATGAAGTATTGTTTCCTTTCTCGAGAAAGGAAACAATACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021153.2-1501s1c1
Sequence:CCGGCCACTGTATGTGCAAGTTCTTCTCGAGAAGAACTTGCACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021153.2-666s1c1
Sequence:CCGGCGATCCCTCAAGTGGTAATAACTCGAGTTATTACCACTTGAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021153.2-488s1c1
Sequence:CCGGCCCAGGTAATAGACATCGCTACTCGAGTAGCGATGTCTATTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_021153.2-1809s1c1
Sequence:CCGGCCCGTCACTTACAAGTACAAACTCGAGTTTGTACTTGTAAGTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021153.2-2500s21c1
Sequence:CCGGCGAACCCAATGGTAGTCTTAACTCGAGTTAAGACTACCATTGGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1438s21c1
Sequence:CCGGGCTTGGTACAACCTAAGTATTCTCGAGAATACTTAGGTTGTACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1413s21c1
Sequence:CCGGTAACTCACTGGATCGTGAAATCTCGAGATTTCACGATCCAGTGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1115s21c1
Sequence:CCGGACCAGAACCACTACGGTATTACTCGAGTAATACCGTAGTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021153.2-1036s21c1
Sequence:CCGGTCGCAAACATTTGACATTATTCTCGAGAATAATGTCAAATGTTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_021153.2-2747s21c1
Sequence:CCGGGTCGATCCTTATGCGATTATACTCGAGTATAATCGCATAAGGATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081386
CDH19 MISSION shRNA Bacterial Glycerol Stock
cadherin 19, type 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1223s21c1
Sequence:CCGGGGCATTAGAGCTAAGGTTAAACTCGAGTTTAACCTTAGCTCTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1162s21c1
Sequence:CCGGCACCCAAGAAGGGATAGTTATCTCGAGATAACTATCCCTTCTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081386.1-2761s21c1
Sequence:CCGGAGAATGAGTACTACAACATTGCTCGAGCAATGTTGTAGTACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1284s21c1
Sequence:CCGGACGCTTCCACAACCTACATTACTCGAGTAATGTAGGTTGTGGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1834s21c1
Sequence:CCGGTAGAACTGGTTTCAATCTTAACTCGAGTTAAGATTGAAACCAGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081386
CDH19 MISSION shRNA shRNA Plasmid DNA
cadherin 19, type 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1223s21c1
Sequence:CCGGGGCATTAGAGCTAAGGTTAAACTCGAGTTTAACCTTAGCTCTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1162s21c1
Sequence:CCGGCACCCAAGAAGGGATAGTTATCTCGAGATAACTATCCCTTCTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081386.1-2761s21c1
Sequence:CCGGAGAATGAGTACTACAACATTGCTCGAGCAATGTTGTAGTACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1284s21c1
Sequence:CCGGACGCTTCCACAACCTACATTACTCGAGTAATGTAGGTTGTGGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1834s21c1
Sequence:CCGGTAGAACTGGTTTCAATCTTAACTCGAGTTAAGATTGAAACCAGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081386
CDH19 MISSION shRNA Lentiviral Transduction Particles
cadherin 19, type 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1223s21c1
Sequence:CCGGGGCATTAGAGCTAAGGTTAAACTCGAGTTTAACCTTAGCTCTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1162s21c1
Sequence:CCGGCACCCAAGAAGGGATAGTTATCTCGAGATAACTATCCCTTCTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081386.1-2761s21c1
Sequence:CCGGAGAATGAGTACTACAACATTGCTCGAGCAATGTTGTAGTACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1284s21c1
Sequence:CCGGACGCTTCCACAACCTACATTACTCGAGTAATGTAGGTTGTGGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081386.1-1834s21c1
Sequence:CCGGTAGAACTGGTTTCAATCTTAACTCGAGTTAAGATTGAAACCAGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks