EMAIL THIS PAGE TO A FRIEND

CDH1

cadherin 1, type 1, E-cadherin (epithelial)

89 Gene Product Result for
Synonyms: Arc-1 CD324 CDHE ECAD LCAM UVO
Gene ID:
Human(999) Summary: This gene is a classical cadherin from the cadherin superfamily. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Mutations in this gene are correlated with gastric, breast, colorectal, thyroid and ovarian cancer. Loss of function is thought to contribute to progression in cancer by increasing proliferation, invasion, and/or metastasis. The ectodomain of this protein mediates bacterial adhesion to mammalian cells and the cytoplasmic domain is required for internalization. Identified transcript variants arise from mutation at consensus splice sites. [provided by RefSeq, Jul 2008]
Mouse(12550) cadherin 1
Rat(83502) cadherin 1
Zebrafish(114424) cadherin 1, epithelial
cow(282637) cadherin 1, type 1, E-cadherin (epithelial)
domestic cat(101095391) cadherin 1, type 1, E-cadherin (epithelial)
dog(442858) cadherin 1, type 1, E-cadherin (epithelial)
chicken(415860) cadherin 1, type 1, E-cadherin (epithelial)
domestic guinea pig(100726210) cadherin 1, type 1, E-cadherin (epithelial)
naked mole-rat(101719565) cadherin 1, type 1, E-cadherin (epithelial)
sheep(101119747) cadherin 1, type 1, E-cadherin (epithelial)
sheep(100294601) cadherin 1, type 1, E-cadherin (epithelial)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500001 Anti-Cadherin-pan, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
GW21186 Anti-CDH1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
SAB2501665 Anti-CDH1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, pig, human, canine
ELISA, western blot pricing
SAB2701861 Anti-cdh1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
HPA004812 Anti-CDH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2104222 Anti-CDH1 antibody produced in rabbit affinity isolated antibody pig, horse, rat, mouse, bovine, rabbit, human
western blot pricing
SAB4300693 Anti-CDH1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB2107370 Anti-CDH1 antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig, horse, rabbit
ELISA, western blot pricing
SAB5500022 Anti-E-Cadherin antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP64, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB4503751 Anti-E-cadherin, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4700694 Monoclonal Anti-CD324-PE antibody produced in mouse clone 67A4, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
WH0000999M1 Monoclonal Anti-CDH1 antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AMAB90862 Monoclonal Anti-CDH1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1170, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90863 Monoclonal Anti-CDH1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1172, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90865 Monoclonal Anti-CDH1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1180, purified immunoglobulin, buffered aqueous glycerol solution human, human
immunohistochemistry, western blot pricing
SAB4700237 Monoclonal Anti-CDH1 antibody produced in mouse clone 67A4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700238 Monoclonal Anti-CDH1-APC antibody produced in mouse clone 67A4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700239 Monoclonal Anti-CDH1-FITC antibody produced in mouse clone 67A4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
C1821 Monoclonal Anti-Pan Cadherin antibody produced in mouse clone CH-19, ascites fluid hamster, mouse, rat, bovine, feline, chicken, human, canine, sheep, frog, guinea pig, pig, snake, Psammomys (sand rat), goat, rabbit
immunofluorescence, immunohistochemistry, microarray, western blot pricing
U3254 Monoclonal Anti-Uvomorulin/E-Cadherin antibody produced in rat clone DECMA-1, ascites fluid, buffered aqueous solution human, bovine, canine, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004360 Rosetta Predictions human pricing
NM_031334 Rosetta Predictions rat pricing
NM_009864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086310 predicted 1350
2 SASI_Hs01_00086311 predicted 2364
3 SASI_Hs01_00086312 predicted 1231
4 SASI_Hs02_00337427 predicted 1623
5 SASI_Hs01_00086313 predicted 840
6 SASI_Hs01_00086314 predicted 2592
7 SASI_Hs01_00086315 predicted 1400
8 SASI_Hs01_00086316 predicted 1800
9 SASI_Hs01_00086317 predicted 669
10 SASI_Hs01_00086318 predicted 1137
11 SASI_Hs01_00086319 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046548 predicted 1391
2 SASI_Rn01_00046549 predicted 1369
3 SASI_Rn02_00264559 predicted 829
4 SASI_Rn01_00046550 predicted 2047
5 SASI_Rn01_00046551 predicted 2380
6 SASI_Rn01_00046552 predicted 2705
7 SASI_Rn01_00046554 predicted 806
8 SASI_Rn01_00046555 predicted 1797
9 SASI_Rn01_00046556 predicted 814
10 SASI_Rn01_00046557 predicted 1814
11 SASI_Rn01_00046553 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120937 predicted 1308
2 SASI_Mm01_00120938 predicted 1212
3 SASI_Mm01_00120940 predicted 2535
4 SASI_Mm01_00120941 predicted 2093
5 SASI_Mm01_00120942 predicted 455
6 SASI_Mm01_00120944 predicted 2046
7 SASI_Mm02_00317296 predicted 2034
8 SASI_Mm01_00120945 predicted 910
9 SASI_Mm01_00120946 predicted 1248
10 SASI_Mm02_00317297 predicted 787
11 SASI_Mm01_00120939 predicted 1362
12 SASI_Mm01_00120943 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004360
VALIDATED
CDH1 MISSION shRNA Bacterial Glycerol Stock
cadherin 1, type 1, E-cadherin (epithelial)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-298s21c1
Sequence:CCGGAGATTGCACCGGTCGACAAAGCTCGAGCTTTGTCGACCGGTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-1904s21c1
Sequence:CCGGATACCAGAACCTCGAACTATACTCGAGTATAGTTCGAGGTTCTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-4624s21c1
Sequence:CCGGTTTCGGCAGTTCAAGCTATATCTCGAGATATAGCTTGAACTGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-2364s21c1
Sequence:CCGGACACCCGGGACAACGTTTATTCTCGAGAATAAACGTTGTCCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-1282s21c1
Sequence:CCGGGAACGAGGCTAACGTCGTAATCTCGAGATTACGACGTTAGCCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004360.2-2057s1c1
Sequence:CCGGCCAACCCAAGAATCTATCATTCTCGAGAATGATAGATTCTTGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004360.2-1409s1c1
Sequence:CCGGCCAGTGAACAACGATGGCATTCTCGAGAATGCCATCGTTGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004360
VALIDATED
CDH1 MISSION shRNA shRNA Plasmid DNA
cadherin 1, type 1, E-cadherin (epithelial)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-298s21c1
Sequence:CCGGAGATTGCACCGGTCGACAAAGCTCGAGCTTTGTCGACCGGTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-1904s21c1
Sequence:CCGGATACCAGAACCTCGAACTATACTCGAGTATAGTTCGAGGTTCTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-4624s21c1
Sequence:CCGGTTTCGGCAGTTCAAGCTATATCTCGAGATATAGCTTGAACTGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-2364s21c1
Sequence:CCGGACACCCGGGACAACGTTTATTCTCGAGAATAAACGTTGTCCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-1282s21c1
Sequence:CCGGGAACGAGGCTAACGTCGTAATCTCGAGATTACGACGTTAGCCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004360.2-2057s1c1
Sequence:CCGGCCAACCCAAGAATCTATCATTCTCGAGAATGATAGATTCTTGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004360.2-1409s1c1
Sequence:CCGGCCAGTGAACAACGATGGCATTCTCGAGAATGCCATCGTTGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004360
VALIDATED
CDH1 MISSION shRNA Lentiviral Transduction Particles
cadherin 1, type 1, E-cadherin (epithelial)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-298s21c1
Sequence:CCGGAGATTGCACCGGTCGACAAAGCTCGAGCTTTGTCGACCGGTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-1904s21c1
Sequence:CCGGATACCAGAACCTCGAACTATACTCGAGTATAGTTCGAGGTTCTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-4624s21c1
Sequence:CCGGTTTCGGCAGTTCAAGCTATATCTCGAGATATAGCTTGAACTGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-2364s21c1
Sequence:CCGGACACCCGGGACAACGTTTATTCTCGAGAATAAACGTTGTCCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004360.3-1282s21c1
Sequence:CCGGGAACGAGGCTAACGTCGTAATCTCGAGATTACGACGTTAGCCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004360.2-2057s1c1
Sequence:CCGGCCAACCCAAGAATCTATCATTCTCGAGAATGATAGATTCTTGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004360.2-1409s1c1
Sequence:CCGGCCAGTGAACAACGATGGCATTCTCGAGAATGCCATCGTTGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009864
CDH1 MISSION shRNA Bacterial Glycerol Stock
cadherin 1, type 1, E-cadherin (epithelial)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009864.1-3734s1c1
Sequence:CCGGGCTGGAATCTTTGTCCATGTACTCGAGTACATGGACAAAGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-1957s1c1
Sequence:CCGGGCCTCATATCATCACCATCTTCTCGAGAAGATGGTGATGATATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-1135s1c1
Sequence:CCGGCCGAGAGAGTTACCCTACATACTCGAGTATGTAGGGTAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-1419s1c1
Sequence:CCGGCCACGACCAATGATGGCATTTCTCGAGAAATGCCATCATTGGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-2378s1c1
Sequence:CCGGCGGGACAATGTGTATTACTATCTCGAGATAGTAATACACATTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009864
CDH1 MISSION shRNA shRNA Plasmid DNA
cadherin 1, type 1, E-cadherin (epithelial)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009864.1-3734s1c1
Sequence:CCGGGCTGGAATCTTTGTCCATGTACTCGAGTACATGGACAAAGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-1957s1c1
Sequence:CCGGGCCTCATATCATCACCATCTTCTCGAGAAGATGGTGATGATATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-1135s1c1
Sequence:CCGGCCGAGAGAGTTACCCTACATACTCGAGTATGTAGGGTAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-1419s1c1
Sequence:CCGGCCACGACCAATGATGGCATTTCTCGAGAAATGCCATCATTGGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-2378s1c1
Sequence:CCGGCGGGACAATGTGTATTACTATCTCGAGATAGTAATACACATTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009864
CDH1 MISSION shRNA Lentiviral Transduction Particles
cadherin 1, type 1, E-cadherin (epithelial)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009864.1-3734s1c1
Sequence:CCGGGCTGGAATCTTTGTCCATGTACTCGAGTACATGGACAAAGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-1957s1c1
Sequence:CCGGGCCTCATATCATCACCATCTTCTCGAGAAGATGGTGATGATATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-1135s1c1
Sequence:CCGGCCGAGAGAGTTACCCTACATACTCGAGTATGTAGGGTAACTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-1419s1c1
Sequence:CCGGCCACGACCAATGATGGCATTTCTCGAGAAATGCCATCATTGGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009864.1-2378s1c1
Sequence:CCGGCGGGACAATGTGTATTACTATCTCGAGATAGTAATACACATTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks