EMAIL THIS PAGE TO A FRIEND

CDH20

cadherin 20, type 2

74 Gene Product Result for
Synonyms: CDH7L3 Cdh7
UniProtKB ID: Q9HBT6, Q495S3
Gene ID:
Human(28316) Summary: This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Mouse(23836) cadherin 20
Rat(363948) cadherin 20
domestic guinea pig(100723010) cadherin 20, type 2
naked mole-rat(101726325) cadherin 20, type 2
sheep(101118069) cadherin 20, type 2
Domestic Rabbit(100356628) cadherin 20, type 2
chicken(373927) cadherin 20, type 2
domestic cat(101081836) cadherin 20, type 2
cow(538924) cadherin 20, type 2
Horse(100050547) cadherin 20, type 2
dog(483959) cadherin 20, type 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031891 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031891 Rosetta Predictions human pricing
NM_001012748 Rosetta Predictions rat pricing
NM_011800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197319 predicted 1454
2 SASI_Hs01_00197320 predicted 381
3 SASI_Hs01_00197321 predicted 859
4 SASI_Hs01_00197322 predicted 239
5 SASI_Hs01_00197323 predicted 996
6 SASI_Hs01_00197324 predicted 507
7 SASI_Hs02_00358999 predicted 1710
8 SASI_Hs01_00197325 predicted 389
9 SASI_Hs01_00197326 predicted 1265
10 SASI_Hs01_00197327 predicted 1433
11 SASI_Hs01_00197318 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120863 predicted 227
2 SASI_Rn01_00120864 predicted 1490
3 SASI_Rn01_00120865 predicted 1882
4 SASI_Rn01_00120866 predicted 561
5 SASI_Rn01_00120867 predicted 378
6 SASI_Rn01_00120868 predicted 1243
7 SASI_Rn01_00120869 predicted 1939
8 SASI_Rn01_00120870 predicted 350
9 SASI_Rn01_00120871 predicted 1468
10 SASI_Rn01_00120872 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181854 predicted 1056
2 SASI_Mm01_00181856 predicted 1460
3 SASI_Mm01_00181858 predicted 1656
4 SASI_Mm01_00181859 predicted 599
5 SASI_Mm01_00181860 predicted 588
6 SASI_Mm01_00181861 predicted 944
7 SASI_Mm02_00321476 predicted 446
8 SASI_Mm02_00321477 predicted 897
9 SASI_Mm01_00181862 predicted 2163
10 SASI_Mm01_00181863 predicted 1276
11 SASI_Mm01_00181855 predicted 2106
12 SASI_Mm01_00181857 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011800
CDH20 MISSION shRNA Bacterial Glycerol Stock
cadherin 20, type 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011800.2-3471s1c1
Sequence:CCGGGCCAAATAAGAAGTATCTGATCTCGAGATCAGATACTTCTTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-1036s1c1
Sequence:CCGGCCCGATTTCCACAGAAACATTCTCGAGAATGTTTCTGTGGAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-1140s1c1
Sequence:CCGGGCAGAGATGAAGTATACCATTCTCGAGAATGGTATACTTCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-2166s1c1
Sequence:CCGGCCCTACATCATCGACGACGATCTCGAGATCGTCGTCGATGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-1865s1c1
Sequence:CCGGCCAAGATAATACTGCTCGGATCTCGAGATCCGAGCAGTATTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-523s21c1
Sequence:CCGGAGGAGCAGGCATCGTGTTTACCTCGAGGTAAACACGATGCCTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-1434s21c1
Sequence:CCGGGAACAACCATACAGATCATTTCTCGAGAAATGATCTGTATGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-1069s21c1
Sequence:CCGGGCTAGAATCTGCTCCAATTAGCTCGAGCTAATTGGAGCAGATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-730s21c1
Sequence:CCGGCATCGCCACTGTGCCAGAAATCTCGAGATTTCTGGCACAGTGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011800
CDH20 MISSION shRNA shRNA Plasmid DNA
cadherin 20, type 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011800.2-3471s1c1
Sequence:CCGGGCCAAATAAGAAGTATCTGATCTCGAGATCAGATACTTCTTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-1036s1c1
Sequence:CCGGCCCGATTTCCACAGAAACATTCTCGAGAATGTTTCTGTGGAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-1140s1c1
Sequence:CCGGGCAGAGATGAAGTATACCATTCTCGAGAATGGTATACTTCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-2166s1c1
Sequence:CCGGCCCTACATCATCGACGACGATCTCGAGATCGTCGTCGATGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-1865s1c1
Sequence:CCGGCCAAGATAATACTGCTCGGATCTCGAGATCCGAGCAGTATTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-523s21c1
Sequence:CCGGAGGAGCAGGCATCGTGTTTACCTCGAGGTAAACACGATGCCTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-1434s21c1
Sequence:CCGGGAACAACCATACAGATCATTTCTCGAGAAATGATCTGTATGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-1069s21c1
Sequence:CCGGGCTAGAATCTGCTCCAATTAGCTCGAGCTAATTGGAGCAGATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-730s21c1
Sequence:CCGGCATCGCCACTGTGCCAGAAATCTCGAGATTTCTGGCACAGTGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011800
CDH20 MISSION shRNA Lentiviral Transduction Particles
cadherin 20, type 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011800.2-3471s1c1
Sequence:CCGGGCCAAATAAGAAGTATCTGATCTCGAGATCAGATACTTCTTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-1036s1c1
Sequence:CCGGCCCGATTTCCACAGAAACATTCTCGAGAATGTTTCTGTGGAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-1140s1c1
Sequence:CCGGGCAGAGATGAAGTATACCATTCTCGAGAATGGTATACTTCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-2166s1c1
Sequence:CCGGCCCTACATCATCGACGACGATCTCGAGATCGTCGTCGATGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011800.2-1865s1c1
Sequence:CCGGCCAAGATAATACTGCTCGGATCTCGAGATCCGAGCAGTATTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-523s21c1
Sequence:CCGGAGGAGCAGGCATCGTGTTTACCTCGAGGTAAACACGATGCCTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-1434s21c1
Sequence:CCGGGAACAACCATACAGATCATTTCTCGAGAAATGATCTGTATGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-1069s21c1
Sequence:CCGGGCTAGAATCTGCTCCAATTAGCTCGAGCTAATTGGAGCAGATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011800.4-730s21c1
Sequence:CCGGCATCGCCACTGTGCCAGAAATCTCGAGATTTCTGGCACAGTGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031891
CDH20 MISSION shRNA Bacterial Glycerol Stock
cadherin 20, type 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-1447s1c1
Sequence:CCGGCCTGTCACAATCAAAGTCTTACTCGAGTAAGACTTTGATTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-973s1c1
Sequence:CCGGGCCTTTGACATTAGCACAGATCTCGAGATCTGTGCTAATGTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-1947s1c1
Sequence:CCGGCCGGAAACAACCATACATCATCTCGAGATGATGTATGGTTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-383s1c1
Sequence:CCGGGAGAGGAAAGAGCCCAGTATACTCGAGTATACTGGGCTCTTTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-800s1c1
Sequence:CCGGCCCTCTCAGATGTCAATGATACTCGAGTATCATTGACATCTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-925s21c1
Sequence:CCGGATCAATGCAGAGATGAAATATCTCGAGATATTTCATCTCTGCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-503s21c1
Sequence:CCGGAGTTCCTGGACGGACCTTATGCTCGAGCATAAGGTCCGTCCAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-2238s21c1
Sequence:CCAGCGACTCCCTCCAGACGTATATCTCGAGATATACGTCTGGAGGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-1226s21c1
Sequence:CCGGGAACAACCATACAGATCATTTCTCGAGAAATGATCTGTATGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031891
CDH20 MISSION shRNA shRNA Plasmid DNA
cadherin 20, type 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-1447s1c1
Sequence:CCGGCCTGTCACAATCAAAGTCTTACTCGAGTAAGACTTTGATTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-973s1c1
Sequence:CCGGGCCTTTGACATTAGCACAGATCTCGAGATCTGTGCTAATGTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-1947s1c1
Sequence:CCGGCCGGAAACAACCATACATCATCTCGAGATGATGTATGGTTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-383s1c1
Sequence:CCGGGAGAGGAAAGAGCCCAGTATACTCGAGTATACTGGGCTCTTTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-800s1c1
Sequence:CCGGCCCTCTCAGATGTCAATGATACTCGAGTATCATTGACATCTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-925s21c1
Sequence:CCGGATCAATGCAGAGATGAAATATCTCGAGATATTTCATCTCTGCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-503s21c1
Sequence:CCGGAGTTCCTGGACGGACCTTATGCTCGAGCATAAGGTCCGTCCAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-2238s21c1
Sequence:CCAGCGACTCCCTCCAGACGTATATCTCGAGATATACGTCTGGAGGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-1226s21c1
Sequence:CCGGGAACAACCATACAGATCATTTCTCGAGAAATGATCTGTATGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031891
CDH20 MISSION shRNA Lentiviral Transduction Particles
cadherin 20, type 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-1447s1c1
Sequence:CCGGCCTGTCACAATCAAAGTCTTACTCGAGTAAGACTTTGATTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-973s1c1
Sequence:CCGGGCCTTTGACATTAGCACAGATCTCGAGATCTGTGCTAATGTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-1947s1c1
Sequence:CCGGCCGGAAACAACCATACATCATCTCGAGATGATGTATGGTTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-383s1c1
Sequence:CCGGGAGAGGAAAGAGCCCAGTATACTCGAGTATACTGGGCTCTTTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031891.2-800s1c1
Sequence:CCGGCCCTCTCAGATGTCAATGATACTCGAGTATCATTGACATCTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-925s21c1
Sequence:CCGGATCAATGCAGAGATGAAATATCTCGAGATATTTCATCTCTGCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-503s21c1
Sequence:CCGGAGTTCCTGGACGGACCTTATGCTCGAGCATAAGGTCCGTCCAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-2238s21c1
Sequence:CCAGCGACTCCCTCCAGACGTATATCTCGAGATATACGTCTGGAGGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031891.2-1226s21c1
Sequence:CCGGGAACAACCATACAGATCATTTCTCGAGAAATGATCTGTATGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks