EMAIL THIS PAGE TO A FRIEND

CDH22

cadherin 22, type 2

94 Gene Product Result for
Synonyms: C20orf25 dJ998H6.1
UniProtKB ID: Q9UJ99, B9EGK7, O43205
Gene ID:
Human(64405) Summary: This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Mouse(104010) cadherin 22
Rat(29182) cadherin 22
chicken(419305) cadherin 22, type 2
cow(540147) cadherin 22, type 2
domestic cat(101085111) cadherin 22, type 2
dog(485906) cadherin 22, type 2
sheep(101114377) cadherin 22, type 2
Domestic Rabbit(100354732) cadherin 22, type 2
naked mole-rat(101715145) cadherin 22, type 2
domestic guinea pig(100729065) cadherin 22, type 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012164 Anti-CDH22 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV49648 Anti-CDH22 antibody produced in rabbit IgG fraction of antiserum bovine, zebrafish, mouse, guinea pig, canine, human, rat, horse, rabbit
western blot pricing
SAB4502757 Anti-CDH22 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021248 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021248 Rosetta Predictions human pricing
NM_019161 Rosetta Predictions rat pricing
NM_174988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042262 predicted 1836
2 SASI_Hs01_00042263 predicted 1902
3 SASI_Hs01_00042264 predicted 2022
4 SASI_Hs01_00042265 predicted 723
5 SASI_Hs01_00042266 predicted 1117
6 SASI_Hs01_00042267 predicted 1334
7 SASI_Hs01_00042268 predicted 1821
8 SASI_Hs02_00354907 predicted 1684
9 SASI_Hs01_00042269 predicted 3015
10 SASI_Hs01_00042270 predicted 938
11 SASI_Hs01_00042271 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261943 predicted 715
2 SASI_Rn02_00261944 predicted 1314
3 SASI_Rn02_00261945 predicted 1504
4 SASI_Rn01_00055170 predicted 1695
5 SASI_Rn01_00055171 predicted 1366
6 SASI_Rn01_00055173 predicted 1228
7 SASI_Rn01_00055174 predicted 1764
8 SASI_Rn02_00261946 predicted 2175
9 SASI_Rn01_00055175 predicted 1680
10 SASI_Rn01_00055176 predicted 1849
11 SASI_Rn01_00055168 predicted 2552
12 SASI_Rn01_00055169 predicted 2556
13 SASI_Rn01_00055172 predicted 961
14 SASI_Rn01_00055177 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147692 predicted 2469
2 SASI_Mm01_00147693 predicted 1414
3 SASI_Mm01_00147694 predicted 1770
4 SASI_Mm01_00147696 predicted 1786
5 SASI_Mm01_00147697 predicted 2081
6 SASI_Mm02_00345526 predicted 1942
7 SASI_Mm01_00147698 predicted 1315
8 SASI_Mm01_00147699 predicted 1456
9 SASI_Mm01_00147700 predicted 2521
10 SASI_Mm01_00147701 predicted 657
11 SASI_Mm01_00147695 predicted 1939
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174988
CDH22 MISSION shRNA Bacterial Glycerol Stock
cadherin 22, type 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174988.3-1778s21c1
Sequence:CCGGATTGATCGGGACTCGGATTTGCTCGAGCAAATCCGAGTCCCGATCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174988.3-1064s21c1
Sequence:CCGGGATGCAGACGACCCTACTTACCTCGAGGTAAGTAGGGTCGTCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174988.3-3217s21c1
Sequence:CCGGGAAGGAAGGGCTGGTCATTTACTCGAGTAAATGACCAGCCCTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174988.3-3193s21c1
Sequence:CCGGGCTTTCTGGCATCCAATTAAACTCGAGTTTAATTGGATGCCAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174988.2-3324s1c1
Sequence:CCGGCCCAGAGAAGTGGATTGACTTCTCGAGAAGTCAATCCACTTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-1192s1c1
Sequence:CCGGCGCTACGAGGTGGTTATTCAACTCGAGTTGAATAACCACCTCGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-2374s1c1
Sequence:CCGGGTTCTCATCCTGGTTGTTCTTCTCGAGAAGAACAACCAGGATGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-924s1c1
Sequence:CCGGCGAGTCGGAGTTCATCATCAACTCGAGTTGATGATGAACTCCGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-2452s1c1
Sequence:CCGGGATGAAGACATGCGGGACAATCTCGAGATTGTCCCGCATGTCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174988
CDH22 MISSION shRNA shRNA Plasmid DNA
cadherin 22, type 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174988.3-1778s21c1
Sequence:CCGGATTGATCGGGACTCGGATTTGCTCGAGCAAATCCGAGTCCCGATCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174988.3-1064s21c1
Sequence:CCGGGATGCAGACGACCCTACTTACCTCGAGGTAAGTAGGGTCGTCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174988.3-3217s21c1
Sequence:CCGGGAAGGAAGGGCTGGTCATTTACTCGAGTAAATGACCAGCCCTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174988.3-3193s21c1
Sequence:CCGGGCTTTCTGGCATCCAATTAAACTCGAGTTTAATTGGATGCCAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174988.2-3324s1c1
Sequence:CCGGCCCAGAGAAGTGGATTGACTTCTCGAGAAGTCAATCCACTTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-1192s1c1
Sequence:CCGGCGCTACGAGGTGGTTATTCAACTCGAGTTGAATAACCACCTCGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-2374s1c1
Sequence:CCGGGTTCTCATCCTGGTTGTTCTTCTCGAGAAGAACAACCAGGATGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-924s1c1
Sequence:CCGGCGAGTCGGAGTTCATCATCAACTCGAGTTGATGATGAACTCCGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-2452s1c1
Sequence:CCGGGATGAAGACATGCGGGACAATCTCGAGATTGTCCCGCATGTCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174988
CDH22 MISSION shRNA Lentiviral Transduction Particles
cadherin 22, type 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174988.3-1778s21c1
Sequence:CCGGATTGATCGGGACTCGGATTTGCTCGAGCAAATCCGAGTCCCGATCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174988.3-1064s21c1
Sequence:CCGGGATGCAGACGACCCTACTTACCTCGAGGTAAGTAGGGTCGTCTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174988.3-3217s21c1
Sequence:CCGGGAAGGAAGGGCTGGTCATTTACTCGAGTAAATGACCAGCCCTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174988.3-3193s21c1
Sequence:CCGGGCTTTCTGGCATCCAATTAAACTCGAGTTTAATTGGATGCCAGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174988.2-3324s1c1
Sequence:CCGGCCCAGAGAAGTGGATTGACTTCTCGAGAAGTCAATCCACTTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-1192s1c1
Sequence:CCGGCGCTACGAGGTGGTTATTCAACTCGAGTTGAATAACCACCTCGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-2374s1c1
Sequence:CCGGGTTCTCATCCTGGTTGTTCTTCTCGAGAAGAACAACCAGGATGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-924s1c1
Sequence:CCGGCGAGTCGGAGTTCATCATCAACTCGAGTTGATGATGAACTCCGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174988.2-2452s1c1
Sequence:CCGGGATGAAGACATGCGGGACAATCTCGAGATTGTCCCGCATGTCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021248
CDH22 MISSION shRNA Bacterial Glycerol Stock
cadherin 22, type 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021248.1-3287s21c1
Sequence:CCGGGAAGGCTGTTCACTTACTAAGCTCGAGCTTAGTAAGTGAACAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021248.1-2437s21c1
Sequence:CCGGACACCGAAGCCTACGACATGTCTCGAGACATGTCGTAGGCTTCGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021248.1-3091s21c1
Sequence:CCGGGATTCTGACCAACGGCATTAACTCGAGTTAATGCCGTTGGTCAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-1316s1c1
Sequence:CCGGCGTGGGAGAGAACACAGACATCTCGAGATGTCTGTGTTCTCTCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-1703s1c1
Sequence:CCGGCGAATCAGATTTGGACCAGATCTCGAGATCTGGTCCAAATCTGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-2400s1c1
Sequence:CCGGGTCATCAAATACAACGACGAACTCGAGTTCGTCGTTGTATTTGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-687s1c1
Sequence:CCGGGCCATCAAGTACACCATCTCACTCGAGTGAGATGGTGTACTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-2390s1c1
Sequence:CCGGGCGGGACAACGTCATCAAATACTCGAGTATTTGATGACGTTGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021248
CDH22 MISSION shRNA shRNA Plasmid DNA
cadherin 22, type 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021248.1-3287s21c1
Sequence:CCGGGAAGGCTGTTCACTTACTAAGCTCGAGCTTAGTAAGTGAACAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021248.1-2437s21c1
Sequence:CCGGACACCGAAGCCTACGACATGTCTCGAGACATGTCGTAGGCTTCGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021248.1-3091s21c1
Sequence:CCGGGATTCTGACCAACGGCATTAACTCGAGTTAATGCCGTTGGTCAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-1316s1c1
Sequence:CCGGCGTGGGAGAGAACACAGACATCTCGAGATGTCTGTGTTCTCTCCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-1703s1c1
Sequence:CCGGCGAATCAGATTTGGACCAGATCTCGAGATCTGGTCCAAATCTGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-2400s1c1
Sequence:CCGGGTCATCAAATACAACGACGAACTCGAGTTCGTCGTTGTATTTGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-687s1c1
Sequence:CCGGGCCATCAAGTACACCATCTCACTCGAGTGAGATGGTGTACTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-2390s1c1
Sequence:CCGGGCGGGACAACGTCATCAAATACTCGAGTATTTGATGACGTTGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021248
CDH22 MISSION shRNA Lentiviral Transduction Particles
cadherin 22, type 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021248.1-3287s21c1
Sequence:CCGGGAAGGCTGTTCACTTACTAAGCTCGAGCTTAGTAAGTGAACAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021248.1-2437s21c1
Sequence:CCGGACACCGAAGCCTACGACATGTCTCGAGACATGTCGTAGGCTTCGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021248.1-3091s21c1
Sequence:CCGGGATTCTGACCAACGGCATTAACTCGAGTTAATGCCGTTGGTCAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-1316s1c1
Sequence:CCGGCGTGGGAGAGAACACAGACATCTCGAGATGTCTGTGTTCTCTCCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-1703s1c1
Sequence:CCGGCGAATCAGATTTGGACCAGATCTCGAGATCTGGTCCAAATCTGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-2400s1c1
Sequence:CCGGGTCATCAAATACAACGACGAACTCGAGTTCGTCGTTGTATTTGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-687s1c1
Sequence:CCGGGCCATCAAGTACACCATCTCACTCGAGTGAGATGGTGTACTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021248.1-2390s1c1
Sequence:CCGGGCGGGACAACGTCATCAAATACTCGAGTATTTGATGACGTTGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)