EMAIL THIS PAGE TO A FRIEND

CDH23

cadherin-related 23

75 Gene Product Result for
Synonyms: CDHR23 USH1D
Gene ID:
Human(64072) Summary: This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
Mouse(22295) cadherin 23 (otocadherin)
Rat(114102) cadherin-related 23
domestic guinea pig(100712756) cadherin-related 23
naked mole-rat(101722650) cadherin-related 23
sheep(101107570) cadherin-related 23
Zebrafish(407978) cadherin-like 23
chicken(423718) cadherin-related 23
cow(784716) cadherin-related 23
Horse(100146534) cadherin-related 23
domestic cat(101095858) cadherin-related 23
dog(100684999) cadherin-related 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022124 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022124 Rosetta Predictions human pricing
NM_052836 Rosetta Predictions human pricing
NM_053644 Rosetta Predictions rat pricing
NM_023370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090377 predicted 1427
2 SASI_Hs01_00090378 predicted 1164
3 SASI_Hs02_00355521 predicted 1266
4 SASI_Hs01_00090379 predicted 1106
5 SASI_Hs01_00090381 predicted 1384
6 SASI_Hs02_00355522 predicted 1308
7 SASI_Hs01_00090382 predicted 907
8 SASI_Hs01_00090383 predicted 1443
9 SASI_Hs01_00090384 predicted 1533
10 SASI_Hs01_00090385 predicted 494
11 SASI_Hs01_00090380 predicted 683
12 SASI_Hs01_00090386 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190637 predicted 1419
2 SASI_Hs01_00190638 predicted 1167
3 SASI_Hs02_00361517 predicted 1261
4 SASI_Hs01_00190639 predicted 1099
5 SASI_Hs01_00190641 predicted 1384
6 SASI_Hs02_00361518 predicted 1315
7 SASI_Hs01_00190642 predicted 906
8 SASI_Hs01_00190643 predicted 1442
9 SASI_Hs01_00190644 predicted 1540
10 SASI_Hs01_00190645 predicted 502
11 SASI_Hs01_00190640 predicted 684
12 SASI_Hs01_00190646 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031556 predicted 7357
2 SASI_Rn01_00031557 predicted 9452
3 SASI_Rn02_00266367 predicted 9591
4 SASI_Rn01_00031558 predicted 7632
5 SASI_Rn01_00031559 predicted 9117
6 SASI_Rn01_00031560 predicted 9599
7 SASI_Rn01_00031561 predicted 8054
8 SASI_Rn01_00031563 predicted 5447
9 SASI_Rn02_00266368 predicted 2439
10 SASI_Rn01_00031564 predicted 4755
11 SASI_Rn01_00031562 predicted 3396
12 SASI_Rn01_00031565 predicted 8064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108762 predicted 9659
2 SASI_Mm01_00108763 predicted 2504
3 SASI_Mm01_00108764 predicted 10058
4 SASI_Mm01_00108765 predicted 7424
5 SASI_Mm01_00108766 predicted 1739
6 SASI_Mm01_00108767 predicted 9667
7 SASI_Mm01_00108768 predicted 4819
8 SASI_Mm02_00327077 predicted 7376
9 SASI_Mm01_00108769 predicted 1122
10 SASI_Mm01_00108770 predicted 1542
11 SASI_Mm01_00108771 predicted 1547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023370
CDH23 MISSION shRNA Bacterial Glycerol Stock
cadherin-related 23
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-8866s1c1
Sequence:CCGGCGCGTGAAGATCGTCATCAATCTCGAGATTGATGACGATCTTCACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-2344s1c1
Sequence:CCGGCCTTACTACATCAACCTGGTACTCGAGTACCAGGTTGATGTAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-7393s1c1
Sequence:CCGGCGAGAGAAGAAGGACCACTATCTCGAGATAGTGGTCCTTCTTCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-1876s1c1
Sequence:CCGGCCTCTGGATTACGAGCAGATACTCGAGTATCTGCTCGTAATCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-79s1c1
Sequence:CCGGCGACTACCTTTCTTCACCAATCTCGAGATTGGTGAAGAAAGGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023370
CDH23 MISSION shRNA shRNA Plasmid DNA
cadherin-related 23
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-8866s1c1
Sequence:CCGGCGCGTGAAGATCGTCATCAATCTCGAGATTGATGACGATCTTCACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-2344s1c1
Sequence:CCGGCCTTACTACATCAACCTGGTACTCGAGTACCAGGTTGATGTAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-7393s1c1
Sequence:CCGGCGAGAGAAGAAGGACCACTATCTCGAGATAGTGGTCCTTCTTCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-1876s1c1
Sequence:CCGGCCTCTGGATTACGAGCAGATACTCGAGTATCTGCTCGTAATCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-79s1c1
Sequence:CCGGCGACTACCTTTCTTCACCAATCTCGAGATTGGTGAAGAAAGGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023370
CDH23 MISSION shRNA Lentiviral Transduction Particles
cadherin-related 23
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-8866s1c1
Sequence:CCGGCGCGTGAAGATCGTCATCAATCTCGAGATTGATGACGATCTTCACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-2344s1c1
Sequence:CCGGCCTTACTACATCAACCTGGTACTCGAGTACCAGGTTGATGTAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-7393s1c1
Sequence:CCGGCGAGAGAAGAAGGACCACTATCTCGAGATAGTGGTCCTTCTTCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-1876s1c1
Sequence:CCGGCCTCTGGATTACGAGCAGATACTCGAGTATCTGCTCGTAATCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023370.1-79s1c1
Sequence:CCGGCGACTACCTTTCTTCACCAATCTCGAGATTGGTGAAGAAAGGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022124
CDH23 MISSION shRNA Bacterial Glycerol Stock
cadherin-related 23
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022124.2-10638s1c1
Sequence:CCGGGCATCTGACCTCTACCTTCATCTCGAGATGAAGGTAGAGGTCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-1385s1c1
Sequence:CCGGCGACCTTCAATATCCTGGTTACTCGAGTAACCAGGATATTGAAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-9255s1c1
Sequence:CCGGGCGCGTCAAGATCGTCATTAACTCGAGTTAATGACGATCTTGACGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-7693s1c1
Sequence:CCGGGCACTCATTGAGTACAGCCTTCTCGAGAAGGCTGTACTCAATGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-6148s1c1
Sequence:CCGGCCAGAGTACAAGCTGACCATTCTCGAGAATGGTCAGCTTGTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022124.5-2284s21c1
Sequence:CCGGATATCCAATGGGCTGATTTATCTCGAGATAAATCAGCCCATTGGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022124
CDH23 MISSION shRNA shRNA Plasmid DNA
cadherin-related 23
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022124.2-10638s1c1
Sequence:CCGGGCATCTGACCTCTACCTTCATCTCGAGATGAAGGTAGAGGTCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-1385s1c1
Sequence:CCGGCGACCTTCAATATCCTGGTTACTCGAGTAACCAGGATATTGAAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-9255s1c1
Sequence:CCGGGCGCGTCAAGATCGTCATTAACTCGAGTTAATGACGATCTTGACGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-7693s1c1
Sequence:CCGGGCACTCATTGAGTACAGCCTTCTCGAGAAGGCTGTACTCAATGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-6148s1c1
Sequence:CCGGCCAGAGTACAAGCTGACCATTCTCGAGAATGGTCAGCTTGTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022124.5-2284s21c1
Sequence:CCGGATATCCAATGGGCTGATTTATCTCGAGATAAATCAGCCCATTGGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022124
CDH23 MISSION shRNA Lentiviral Transduction Particles
cadherin-related 23
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022124.2-10638s1c1
Sequence:CCGGGCATCTGACCTCTACCTTCATCTCGAGATGAAGGTAGAGGTCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-1385s1c1
Sequence:CCGGCGACCTTCAATATCCTGGTTACTCGAGTAACCAGGATATTGAAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-9255s1c1
Sequence:CCGGGCGCGTCAAGATCGTCATTAACTCGAGTTAATGACGATCTTGACGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-7693s1c1
Sequence:CCGGGCACTCATTGAGTACAGCCTTCTCGAGAAGGCTGTACTCAATGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022124.2-6148s1c1
Sequence:CCGGCCAGAGTACAAGCTGACCATTCTCGAGAATGGTCAGCTTGTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022124.5-2284s21c1
Sequence:CCGGATATCCAATGGGCTGATTTATCTCGAGATAAATCAGCCCATTGGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)