EMAIL THIS PAGE TO A FRIEND

CDH24

cadherin 24, type 2

83 Gene Product Result for
Synonyms: CDH11L
UniProtKB ID: Q86UP0, D3DS44, Q86UP1, Q9NT84
Gene ID:
Mouse(239096) cadherin-like 24
Rat(498515) cadherin 24, type 2
cow(535046) cadherin 24, type 2
Horse(100055945) cadherin 24, type 2
dog(490605) cadherin 24, type 2
domestic cat(101092614) cadherin 24, type 2
sheep(101123215) cadherin 24, type 2
naked mole-rat(101719340) cadherin 24, type 2
domestic guinea pig(100717757) cadherin 24, type 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022478 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022478 Rosetta Predictions human pricing
NM_144985 Rosetta Predictions human pricing
XM_001054792 Rosetta Predictions rat pricing
XM_573774 Rosetta Predictions rat pricing
NM_199470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233767 predicted 379
2 SASI_Hs02_00355759 predicted 599
3 SASI_Hs01_00233768 predicted 663
4 SASI_Hs01_00233769 predicted 648
5 SASI_Hs01_00233770 predicted 634
6 SASI_Hs01_00233771 predicted 694
7 SASI_Hs01_00233772 predicted 829
8 SASI_Hs01_00233773 predicted 863
9 SASI_Hs01_00233774 predicted 1116
10 SASI_Hs01_00233775 predicted 821
11 SASI_Hs01_00233766 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141172 predicted 381
2 SASI_Hs02_00364793 predicted 602
3 SASI_Hs01_00141173 predicted 668
4 SASI_Hs01_00141174 predicted 656
5 SASI_Hs01_00141175 predicted 636
6 SASI_Hs01_00141176 predicted 698
7 SASI_Hs01_00141177 predicted 821
8 SASI_Hs01_00141178 predicted 871
9 SASI_Hs01_00141179 predicted 1112
10 SASI_Hs01_00141180 predicted 821
11 SASI_Hs01_00141171 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277256 predicted 1624
2 SASI_Rn02_00277257 predicted 1257
3 SASI_Rn02_00277258 predicted 558
4 SASI_Rn02_00277259 predicted 2355
5 SASI_Rn02_00277260 predicted 2312
6 SASI_Rn02_00277261 predicted 2037
7 SASI_Rn02_00277262 predicted 524
8 SASI_Rn02_00277263 predicted 934
9 SASI_Rn02_00277264 predicted 1039
10 SASI_Rn02_00277265 predicted 1833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400741 predicted 363
2 SASI_Rn02_00400742 predicted 358
3 SASI_Rn02_00400743 predicted 322
4 SASI_Rn02_00400744 predicted 312
5 SASI_Rn02_00400745 predicted 365
6 SASI_Rn02_00400746 predicted 1617
7 SASI_Rn02_00400747 predicted 1257
8 SASI_Rn02_00400748 predicted 551
9 SASI_Rn02_00400749 predicted 2354
10 SASI_Rn02_00400750 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060110 predicted 760
2 SASI_Mm02_00351477 predicted 505
3 SASI_Mm01_00060111 predicted 989
4 SASI_Mm01_00060112 predicted 1567
5 SASI_Mm01_00060113 predicted 1114
6 SASI_Mm01_00060114 predicted 2034
7 SASI_Mm02_00351478 predicted 367
8 SASI_Mm01_00060117 predicted 693
9 SASI_Mm01_00060118 predicted 2367
10 SASI_Mm02_00351479 predicted 2148
11 SASI_Mm01_00060109 predicted 1207
12 SASI_Mm01_00060115 predicted 1560
13 SASI_Mm01_00060116 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199470
CDH24 MISSION shRNA Bacterial Glycerol Stock
cadherin 24, type 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199470.2-1032s21c1
Sequence:CCGGCAAGTTCCCTCAGAGTCTATACTCGAGTATAGACTCTGAGGGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199470.2-414s21c1
Sequence:CCGGCTTTGTCATTGAGGAATATTCCTCGAGGAATATTCCTCAATGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1866s1c1
Sequence:CCGGCCCTACCTGATTCCTATCGAACTCGAGTTCGATAGGAATCAGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-611s1c1
Sequence:CCGGCCCATCGGAGTTCATCATCAACTCGAGTTGATGATGAACTCCGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1209s1c1
Sequence:CCGGCGCTCTTACACCTTCCGTGTACTCGAGTACACGGAAGGTGTAAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1659s1c1
Sequence:CCGGCCCTATGACATCTTTGTATGTCTCGAGACATACAAAGATGTCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1729s1c1
Sequence:CCGGGAGATGAAGTTGGCAACAGTACTCGAGTACTGTTGCCAACTTCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199470
CDH24 MISSION shRNA shRNA Plasmid DNA
cadherin 24, type 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199470.2-1032s21c1
Sequence:CCGGCAAGTTCCCTCAGAGTCTATACTCGAGTATAGACTCTGAGGGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199470.2-414s21c1
Sequence:CCGGCTTTGTCATTGAGGAATATTCCTCGAGGAATATTCCTCAATGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1866s1c1
Sequence:CCGGCCCTACCTGATTCCTATCGAACTCGAGTTCGATAGGAATCAGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-611s1c1
Sequence:CCGGCCCATCGGAGTTCATCATCAACTCGAGTTGATGATGAACTCCGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1209s1c1
Sequence:CCGGCGCTCTTACACCTTCCGTGTACTCGAGTACACGGAAGGTGTAAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1659s1c1
Sequence:CCGGCCCTATGACATCTTTGTATGTCTCGAGACATACAAAGATGTCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1729s1c1
Sequence:CCGGGAGATGAAGTTGGCAACAGTACTCGAGTACTGTTGCCAACTTCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199470
CDH24 MISSION shRNA Lentiviral Transduction Particles
cadherin 24, type 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199470.2-1032s21c1
Sequence:CCGGCAAGTTCCCTCAGAGTCTATACTCGAGTATAGACTCTGAGGGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199470.2-414s21c1
Sequence:CCGGCTTTGTCATTGAGGAATATTCCTCGAGGAATATTCCTCAATGACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1866s1c1
Sequence:CCGGCCCTACCTGATTCCTATCGAACTCGAGTTCGATAGGAATCAGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-611s1c1
Sequence:CCGGCCCATCGGAGTTCATCATCAACTCGAGTTGATGATGAACTCCGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1209s1c1
Sequence:CCGGCGCTCTTACACCTTCCGTGTACTCGAGTACACGGAAGGTGTAAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1659s1c1
Sequence:CCGGCCCTATGACATCTTTGTATGTCTCGAGACATACAAAGATGTCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199470.1-1729s1c1
Sequence:CCGGGAGATGAAGTTGGCAACAGTACTCGAGTACTGTTGCCAACTTCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022478
VALIDATED
CDH24 MISSION shRNA Bacterial Glycerol Stock
cadherin 24, type 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022478.3-2916s21c1
Sequence:CCGGCCAGGAATCTTTGTCTCTATCCTCGAGGATAGAGACAAAGATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-412s21c1
Sequence:CCGGTCTTTGTCATTGAGGAATATGCTCGAGCATATTCCTCAATGACAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-1774s21c1
Sequence:CCGGTCCAGACCCTGGATGAGAATGCTCGAGCATTCTCATCCAGGGTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-436s21c1
Sequence:CCGGGTCCAGAGCCTGTTCTCATTGCTCGAGCAATGAGAACAGGCTCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-544s21c1
Sequence:CCGGATGAGGCCACAGGCAATATTCCTCGAGGAATATTGCCTGTGGCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-1129s21c1
Sequence:CCGGACAACGCCCTGATGGCATACACTCGAGTGTATGCCATCAGGGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-1810s21c1
Sequence:CCGGTGGCTGAGCCCTACGATACTTCTCGAGAAGTATCGTAGGGCTCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-458s21c1
Sequence:CCGGCAAGCTGCACTCGGATGTTGACTCGAGTCAACATCCGAGTGCAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_022478.2-383s1c1
Sequence:CCGGCCACAGGCAATATTCATGTTACTCGAGTAACATGAATATTGCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022478.2-521s1c1
Sequence:CCGGTCAACGACAATCCACCCATTTCTCGAGAAATGGGTGGATTGTCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022478.2-1011s1c1
Sequence:CCGGCTTCAGCATCAGCACAGACTTCTCGAGAAGTCTGTGCTGATGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022478.2-2127s1c1
Sequence:CCGGCCGAGAGAACATCATCACCTACTCGAGTAGGTGATGATGTTCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022478.2-1858s1c1
Sequence:CCGGCCCTACTTGGTTCCCATAGAACTCGAGTTCTATGGGAACCAAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022478
VALIDATED
CDH24 MISSION shRNA shRNA Plasmid DNA
cadherin 24, type 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022478.3-2916s21c1
Sequence:CCGGCCAGGAATCTTTGTCTCTATCCTCGAGGATAGAGACAAAGATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-412s21c1
Sequence:CCGGTCTTTGTCATTGAGGAATATGCTCGAGCATATTCCTCAATGACAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-1774s21c1
Sequence:CCGGTCCAGACCCTGGATGAGAATGCTCGAGCATTCTCATCCAGGGTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-436s21c1
Sequence:CCGGGTCCAGAGCCTGTTCTCATTGCTCGAGCAATGAGAACAGGCTCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-544s21c1
Sequence:CCGGATGAGGCCACAGGCAATATTCCTCGAGGAATATTGCCTGTGGCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-1129s21c1
Sequence:CCGGACAACGCCCTGATGGCATACACTCGAGTGTATGCCATCAGGGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-1810s21c1
Sequence:CCGGTGGCTGAGCCCTACGATACTTCTCGAGAAGTATCGTAGGGCTCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-458s21c1
Sequence:CCGGCAAGCTGCACTCGGATGTTGACTCGAGTCAACATCCGAGTGCAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_022478.2-383s1c1
Sequence:CCGGCCACAGGCAATATTCATGTTACTCGAGTAACATGAATATTGCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022478.2-521s1c1
Sequence:CCGGTCAACGACAATCCACCCATTTCTCGAGAAATGGGTGGATTGTCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022478.2-1011s1c1
Sequence:CCGGCTTCAGCATCAGCACAGACTTCTCGAGAAGTCTGTGCTGATGCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022478.2-2127s1c1
Sequence:CCGGCCGAGAGAACATCATCACCTACTCGAGTAGGTGATGATGTTCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022478.2-1858s1c1
Sequence:CCGGCCCTACTTGGTTCCCATAGAACTCGAGTTCTATGGGAACCAAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022478
VALIDATED
CDH24 MISSION shRNA Lentiviral Transduction Particles
cadherin 24, type 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022478.3-2916s21c1
Sequence:CCGGCCAGGAATCTTTGTCTCTATCCTCGAGGATAGAGACAAAGATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-412s21c1
Sequence:CCGGTCTTTGTCATTGAGGAATATGCTCGAGCATATTCCTCAATGACAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-1774s21c1
Sequence:CCGGTCCAGACCCTGGATGAGAATGCTCGAGCATTCTCATCCAGGGTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-436s21c1
Sequence:CCGGGTCCAGAGCCTGTTCTCATTGCTCGAGCAATGAGAACAGGCTCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-544s21c1
Sequence:CCGGATGAGGCCACAGGCAATATTCCTCGAGGAATATTGCCTGTGGCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-1129s21c1
Sequence:CCGGACAACGCCCTGATGGCATACACTCGAGTGTATGCCATCAGGGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-1810s21c1
Sequence:CCGGTGGCTGAGCCCTACGATACTTCTCGAGAAGTATCGTAGGGCTCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022478.3-458s21c1
Sequence:CCGGCAAGCTGCACTCGGATGTTGACTCGAGTCAACATCCGAGTGCAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_022478.2-383s1c1
Sequence:CCGGCCACAGGCAATATTCATGTTACTCGAGTAACATGAATATTGCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022478.2-521s1c1
Sequence:CCGGTCAACGACAATCCACCCATTTCTCGAGAAATGGGTGGATTGTCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022478.2-1011s1c1
Sequence:CCGGCTTCAGCATCAGCACAGACTTCTCGAGAAGTCTGTGCTGATGCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022478.2-2127s1c1
Sequence:CCGGCCGAGAGAACATCATCACCTACTCGAGTAGGTGATGATGTTCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022478.2-1858s1c1
Sequence:CCGGCCCTACTTGGTTCCCATAGAACTCGAGTTCTATGGGAACCAAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)