EMAIL THIS PAGE TO A FRIEND

CDH26

cadherin 26

85 Gene Product Result for
Synonyms: VR20
Gene ID:
Human(60437) Summary: Cadherins are a family of adhesion molecules that mediate Ca2+-dependent cell-cell adhesion in all solid tissues and modulate a wide variety of processes, including cell polarization and migration. Cadherin domains occur as repeats in the extracellular region and are thought to contribute to the sorting of heterogeneous cell types and the maintenance of orderly structures such as epithelium. This gene encodes a cadherin domain-containing protein whose specific function has not yet been determined. Alternative splicing occurs at this locus and two transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jul 2008]
Mouse(381409) cadherin-like 26
Rat(311693) cadherin 26
sheep(101122970) cadherin 26
cow(617096) cadherin 26
dog(485954) cadherin 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021810 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057011 MISSION® esiRNA esiRNA targeting mouse Cdh26 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021810 Rosetta Predictions human pricing
NM_177980 Rosetta Predictions human pricing
XM_001060143 Rosetta Predictions rat pricing
XM_230942 Rosetta Predictions rat pricing
NM_198656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121286 predicted 459
2 SASI_Hs01_00121287 predicted 450
3 SASI_Hs01_00121288 predicted 420
4 SASI_Hs01_00121290 predicted 437
5 SASI_Hs01_00121291 predicted 414
6 SASI_Hs01_00121292 predicted 462
7 SASI_Hs01_00121293 predicted 433
8 SASI_Hs02_00355122 predicted 464
9 SASI_Hs02_00355123 predicted 423
10 SASI_Hs02_00355124 predicted 728
11 SASI_Hs01_00121289 predicted 470
12 SASI_Hs01_00121294 predicted 471
13 SASI_Hs01_00121295 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243675 predicted 2563
2 SASI_Hs01_00243676 predicted 2548
3 SASI_Hs01_00243677 predicted 2527
4 SASI_Hs01_00243679 predicted 2546
5 SASI_Hs01_00243680 predicted 2520
6 SASI_Hs01_00243681 predicted 2573
7 SASI_Hs01_00243682 predicted 2543
8 SASI_Hs02_00369454 predicted 2570
9 SASI_Hs02_00369455 predicted 2527
10 SASI_Hs02_00369456 predicted 949
11 SASI_Hs01_00243678 predicted 2574
12 SASI_Hs01_00243683 predicted 2579
13 SASI_Hs01_00243684 predicted 2574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295508 predicted 2004
2 SASI_Rn02_00295509 predicted 922
3 SASI_Rn02_00295510 predicted 561
4 SASI_Rn02_00295511 predicted 1303
5 SASI_Rn02_00295512 predicted 911
6 SASI_Rn02_00295513 predicted 520
7 SASI_Rn02_00295514 predicted 1207
8 SASI_Rn02_00295515 predicted 1442
9 SASI_Rn02_00295516 predicted 1903
10 SASI_Rn02_00295517 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386562 predicted 1057
2 SASI_Rn02_00386563 predicted 698
3 SASI_Rn02_00386564 predicted 1444
4 SASI_Rn02_00386565 predicted 1053
5 SASI_Rn02_00386566 predicted 658
6 SASI_Rn02_00386567 predicted 1349
7 SASI_Rn02_00386568 predicted 1582
8 SASI_Rn02_00386569 predicted 1303
9 SASI_Rn02_00386570 predicted 876
10 SASI_Rn02_00386571 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351122 predicted 1391
2 SASI_Mm02_00351123 predicted 1622
3 SASI_Mm02_00351124 predicted 1015
4 SASI_Mm02_00351125 predicted 1666
5 SASI_Mm02_00351126 predicted 1104
6 SASI_Mm02_00351127 predicted 1498
7 SASI_Mm02_00351128 predicted 937
8 SASI_Mm02_00351129 predicted 703
9 SASI_Mm02_00351130 predicted 2089
10 SASI_Mm02_00351131 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198656
CDH26 MISSION shRNA Bacterial Glycerol Stock
cadherin 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-2131s1c1
Sequence:CCGGCCAGGGTTGTGACACTTTCTTCTCGAGAAGAAAGTGTCACAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-1105s1c1
Sequence:CCGGCCAAGGGTTGTTAAGTATTATCTCGAGATAATACTTAACAACCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-594s1c1
Sequence:CCGGCCCAGTTTCCTGAGAAGGAATCTCGAGATTCCTTCTCAGGAAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198656.1-2582s1c1
Sequence:CCGGCTTGGGAAACATCTGGGAGATCTCGAGATCTCCCAGATGTTTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-672s1c1
Sequence:CCGGCGGTCGATTTGGACCAAGAAACTCGAGTTTCTTGGTCCAAATCGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198656
CDH26 MISSION shRNA shRNA Plasmid DNA
cadherin 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-2131s1c1
Sequence:CCGGCCAGGGTTGTGACACTTTCTTCTCGAGAAGAAAGTGTCACAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-1105s1c1
Sequence:CCGGCCAAGGGTTGTTAAGTATTATCTCGAGATAATACTTAACAACCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-594s1c1
Sequence:CCGGCCCAGTTTCCTGAGAAGGAATCTCGAGATTCCTTCTCAGGAAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198656.1-2582s1c1
Sequence:CCGGCTTGGGAAACATCTGGGAGATCTCGAGATCTCCCAGATGTTTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-672s1c1
Sequence:CCGGCGGTCGATTTGGACCAAGAAACTCGAGTTTCTTGGTCCAAATCGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198656
CDH26 MISSION shRNA Lentiviral Transduction Particles
cadherin 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-2131s1c1
Sequence:CCGGCCAGGGTTGTGACACTTTCTTCTCGAGAAGAAAGTGTCACAACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-1105s1c1
Sequence:CCGGCCAAGGGTTGTTAAGTATTATCTCGAGATAATACTTAACAACCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-594s1c1
Sequence:CCGGCCCAGTTTCCTGAGAAGGAATCTCGAGATTCCTTCTCAGGAAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198656.1-2582s1c1
Sequence:CCGGCTTGGGAAACATCTGGGAGATCTCGAGATCTCCCAGATGTTTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198656.1-672s1c1
Sequence:CCGGCGGTCGATTTGGACCAAGAAACTCGAGTTTCTTGGTCCAAATCGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021810
VALIDATED
CDH26 MISSION shRNA Bacterial Glycerol Stock
cadherin 26
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-474s1c1
Sequence:CCGGGCAGAGACATTGAATCAGAAACTCGAGTTTCTGATTCAATGTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-626s1c1
Sequence:CCGGGCTGGACTCTTTGGGTTCAAACTCGAGTTTGAACCCAAAGAGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-370s1c1
Sequence:CCGGGCAAGCCCTTTGAGCCAAGAACTCGAGTTCTTGGCTCAAAGGGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-650s1c1
Sequence:CCGGGACTCCGTTTGAGGAAATATACTCGAGTATATTTCCTCAAACGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-537s1c1
Sequence:CCGGCCTCACGTCTACAGCGAGGAACTCGAGTTCCTCGCTGTAGACGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-812s21c1
Sequence:CCGGAGGATGAGGACACACTATTAGCTCGAGCTAATAGTGTGTCCTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-650s21c1
Sequence:CCGGGACTCCGTTTGAGGAAATATACTCGAGTATATTTCCTCAAACGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-626s21c1
Sequence:CCGGGCTGGACTCTTTGGGTTCAAACTCGAGTTTGAACCCAAAGAGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-474s21c1
Sequence:CCGGGCAGAGACATTGAATCAGAAACTCGAGTTTCTGATTCAATGTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021810
VALIDATED
CDH26 MISSION shRNA shRNA Plasmid DNA
cadherin 26
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-474s1c1
Sequence:CCGGGCAGAGACATTGAATCAGAAACTCGAGTTTCTGATTCAATGTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-626s1c1
Sequence:CCGGGCTGGACTCTTTGGGTTCAAACTCGAGTTTGAACCCAAAGAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-370s1c1
Sequence:CCGGGCAAGCCCTTTGAGCCAAGAACTCGAGTTCTTGGCTCAAAGGGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-650s1c1
Sequence:CCGGGACTCCGTTTGAGGAAATATACTCGAGTATATTTCCTCAAACGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-537s1c1
Sequence:CCGGCCTCACGTCTACAGCGAGGAACTCGAGTTCCTCGCTGTAGACGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-812s21c1
Sequence:CCGGAGGATGAGGACACACTATTAGCTCGAGCTAATAGTGTGTCCTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-650s21c1
Sequence:CCGGGACTCCGTTTGAGGAAATATACTCGAGTATATTTCCTCAAACGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-626s21c1
Sequence:CCGGGCTGGACTCTTTGGGTTCAAACTCGAGTTTGAACCCAAAGAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-474s21c1
Sequence:CCGGGCAGAGACATTGAATCAGAAACTCGAGTTTCTGATTCAATGTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021810
VALIDATED
CDH26 MISSION shRNA Lentiviral Transduction Particles
cadherin 26
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-474s1c1
Sequence:CCGGGCAGAGACATTGAATCAGAAACTCGAGTTTCTGATTCAATGTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-626s1c1
Sequence:CCGGGCTGGACTCTTTGGGTTCAAACTCGAGTTTGAACCCAAAGAGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-370s1c1
Sequence:CCGGGCAAGCCCTTTGAGCCAAGAACTCGAGTTCTTGGCTCAAAGGGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-650s1c1
Sequence:CCGGGACTCCGTTTGAGGAAATATACTCGAGTATATTTCCTCAAACGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021810.3-537s1c1
Sequence:CCGGCCTCACGTCTACAGCGAGGAACTCGAGTTCCTCGCTGTAGACGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-812s21c1
Sequence:CCGGAGGATGAGGACACACTATTAGCTCGAGCTAATAGTGTGTCCTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-650s21c1
Sequence:CCGGGACTCCGTTTGAGGAAATATACTCGAGTATATTTCCTCAAACGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-626s21c1
Sequence:CCGGGCTGGACTCTTTGGGTTCAAACTCGAGTTTGAACCCAAAGAGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021810.3-474s21c1
Sequence:CCGGGCAGAGACATTGAATCAGAAACTCGAGTTTCTGATTCAATGTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)