EMAIL THIS PAGE TO A FRIEND

CDH2

cadherin 2, type 1, N-cadherin (neuronal)

160 Gene Product Result for
Synonyms: CD325 CDHN CDw325 NCAD
UniProtKB ID: P19022, B0YIY6, Q14923, Q8N173
Gene ID:
Human(1000) Summary: This gene is a classical cadherin from the cadherin superfamily. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. The protein functions during gastrulation and is required for establishment of left-right asymmetry. At certain central nervous system synapses, presynaptic to postsynaptic adhesion is mediated at least in part by this gene product. [provided by RefSeq, Jul 2008]
Mouse(12558) cadherin 2
Rat(83501) cadherin 2
Zebrafish(30291) cadherin 2, neuronal
dog(480169) cadherin 2, type 1, N-cadherin (neuronal)
cow(281062) cadherin 2, type 1, N-cadherin (neuronal)
Horse(100065078) cadherin 2, type 1, N-cadherin (neuronal)
domestic cat(101082701) cadherin 2, type 1, N-cadherin (neuronal)
chicken(414745) cadherin 2, type 1, N-cadherin (neuronal)
sheep(100170321) cadherin 2, type 1, N-cadherin (neuronal)
Domestic Rabbit(100328895) cadherin 2, type 1, N-cadherin (neuronal)
naked mole-rat(101700672) cadherin 2, type 1, N-cadherin (neuronal)
domestic guinea pig(100714783) cadherin 2, type 1, N-cadherin (neuronal)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105438 Anti-CDH2 (66-80) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105439 Anti-CDH2 (806-820) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2702402 Anti-Cdh2 antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
HPA058574 Anti-CDH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4300621 Anti-CDH2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4500002 Anti-CDH2, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB5500023 Anti-N-Cadherin, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP90, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
C3678 Anti-Pan Cadherin antibody produced in rabbit whole antiserum cat, rabbit, human, chicken
immunofluorescence, immunohistochemistry, western blot pricing
WH0001000M1 Monoclonal Anti-CDH2 antibody produced in mouse clone 5C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB91220 Monoclonal Anti-CDH2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3716, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
C2542 Monoclonal Anti-N-Cadherin antibody produced in mouse clone GC-4, ascites fluid rat, human, mouse, chicken, rabbit
electron microscopy, immunohistochemistry, microarray, western blot pricing
C3865 Monoclonal Anti-N-Cadherin antibody produced in mouse clone GC-4, purified from hybridoma cell culture chicken, monkey, rabbit, human, mouse, rat
electron microscopy, flow cytometry, immunocytochemistry, immunohistochemistry, western blot pricing
C1821 Monoclonal Anti-Pan Cadherin antibody produced in mouse clone CH-19, ascites fluid hamster, mouse, rat, bovine, feline, chicken, human, canine, sheep, frog, guinea pig, pig, snake, Psammomys (sand rat), goat, rabbit
immunofluorescence, immunohistochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001792 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001792 Rosetta Predictions human pricing
NM_031333 Rosetta Predictions rat pricing
NM_007664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153991 predicted 1636
2 SASI_Hs01_00153992 predicted 1529
3 SASI_Hs01_00153995 predicted 730
4 SASI_Hs01_00153996 predicted 2751
5 SASI_Hs01_00153997 predicted 1658
6 SASI_Hs01_00153998 predicted 984
7 SASI_Hs01_00153999 predicted 2978
8 SASI_Hs02_00332559 predicted 1769
9 SASI_Hs01_00154000 predicted 1025
10 SASI_Hs02_00332560 predicted 1339
11 SASI_Hs01_00153993 predicted 1606
12 SASI_Hs01_00153994 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099449 predicted 1691
2 SASI_Rn01_00099451 predicted 2740
3 SASI_Rn01_00099452 predicted 3113
4 SASI_Rn01_00099453 predicted 873
5 SASI_Rn01_00099454 predicted 1218
6 SASI_Rn02_00264556 predicted 1510
7 SASI_Rn02_00264557 predicted 1349
8 SASI_Rn01_00099456 predicted 2170
9 SASI_Rn02_00264558 predicted 1652
10 SASI_Rn01_00099457 predicted 2567
11 SASI_Rn01_00099450 predicted 2508
12 SASI_Rn01_00099455 predicted 2111
13 SASI_Rn01_00099458 predicted 2443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312169 predicted 1445
2 SASI_Mm01_00152967 predicted 1793
3 SASI_Mm01_00152968 predicted 2021
4 SASI_Mm01_00152969 predicted 1334
5 SASI_Mm01_00152970 predicted 2290
6 SASI_Mm01_00152971 predicted 2507
7 SASI_Mm02_00312170 predicted 1672
8 SASI_Mm01_00152972 predicted 1191
9 SASI_Mm01_00152973 predicted 1963
10 SASI_Mm01_00152974 predicted 3198
11 SASI_Mm01_00152975 predicted 2806
12 SASI_Mm01_00152976 predicted 2199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007664
VALIDATED
CDH2 MISSION shRNA Bacterial Glycerol Stock
cadherin 2, type 1, N-cadherin (neuronal)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-3410s21c1
Sequence:CCGGGAACAGTTTCACCTGATATTCCTCGAGGAATATCAGGTGAAACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-1370s21c1
Sequence:CCGGGCAGTGGACATCAATGGCAATCTCGAGATTGCCATTGATGTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-1805s21c1
Sequence:CCGGGCCATGACTTTCTACGGAGAACTCGAGTTCTCCGTAGAAAGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-949s21c1
Sequence:CCGGGCAGGCAAAGTTCCTGATATACTCGAGTATATCAGGAACTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-3791s21c1
Sequence:CCGGGAACGAAACAACCAGATTAAACTCGAGTTTAATCTGGTTGTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007664.4-3298s21c1
Sequence:CCGGCCAGGACTATGACTACCTGAACTCGAGTTCAGGTAGTCATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007664.1-3932s1c1
Sequence:CCGGGCTGTAGTTAGAATACTCAATCTCGAGATTGAGTATTCTAACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007664.1-1482s1c1
Sequence:CCGGGCCATGACTTTCTACGGAGAACTCGAGTTCTCCGTAGAAAGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007664.1-2975s1c1
Sequence:CCGGCCAGGACTATGACTACCTGAACTCGAGTTCAGGTAGTCATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007664.1-1047s1c1
Sequence:CCGGGCAGTGGACATCAATGGCAATCTCGAGATTGCCATTGATGTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007664.1-626s1c1
Sequence:CCGGGCAGGCAAAGTTCCTGATATACTCGAGTATATCAGGAACTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007664
VALIDATED
CDH2 MISSION shRNA shRNA Plasmid DNA
cadherin 2, type 1, N-cadherin (neuronal)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-3410s21c1
Sequence:CCGGGAACAGTTTCACCTGATATTCCTCGAGGAATATCAGGTGAAACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-1370s21c1
Sequence:CCGGGCAGTGGACATCAATGGCAATCTCGAGATTGCCATTGATGTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-1805s21c1
Sequence:CCGGGCCATGACTTTCTACGGAGAACTCGAGTTCTCCGTAGAAAGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-949s21c1
Sequence:CCGGGCAGGCAAAGTTCCTGATATACTCGAGTATATCAGGAACTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-3791s21c1
Sequence:CCGGGAACGAAACAACCAGATTAAACTCGAGTTTAATCTGGTTGTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007664.4-3298s21c1
Sequence:CCGGCCAGGACTATGACTACCTGAACTCGAGTTCAGGTAGTCATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007664.1-3932s1c1
Sequence:CCGGGCTGTAGTTAGAATACTCAATCTCGAGATTGAGTATTCTAACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007664.1-1482s1c1
Sequence:CCGGGCCATGACTTTCTACGGAGAACTCGAGTTCTCCGTAGAAAGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007664.1-2975s1c1
Sequence:CCGGCCAGGACTATGACTACCTGAACTCGAGTTCAGGTAGTCATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007664.1-1047s1c1
Sequence:CCGGGCAGTGGACATCAATGGCAATCTCGAGATTGCCATTGATGTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007664.1-626s1c1
Sequence:CCGGGCAGGCAAAGTTCCTGATATACTCGAGTATATCAGGAACTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007664
VALIDATED
CDH2 MISSION shRNA Lentiviral Transduction Particles
cadherin 2, type 1, N-cadherin (neuronal)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-3410s21c1
Sequence:CCGGGAACAGTTTCACCTGATATTCCTCGAGGAATATCAGGTGAAACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-1370s21c1
Sequence:CCGGGCAGTGGACATCAATGGCAATCTCGAGATTGCCATTGATGTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-1805s21c1
Sequence:CCGGGCCATGACTTTCTACGGAGAACTCGAGTTCTCCGTAGAAAGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-949s21c1
Sequence:CCGGGCAGGCAAAGTTCCTGATATACTCGAGTATATCAGGAACTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007664.4-3791s21c1
Sequence:CCGGGAACGAAACAACCAGATTAAACTCGAGTTTAATCTGGTTGTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007664.4-3298s21c1
Sequence:CCGGCCAGGACTATGACTACCTGAACTCGAGTTCAGGTAGTCATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007664.1-3932s1c1
Sequence:CCGGGCTGTAGTTAGAATACTCAATCTCGAGATTGAGTATTCTAACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007664.1-1482s1c1
Sequence:CCGGGCCATGACTTTCTACGGAGAACTCGAGTTCTCCGTAGAAAGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007664.1-2975s1c1
Sequence:CCGGCCAGGACTATGACTACCTGAACTCGAGTTCAGGTAGTCATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007664.1-1047s1c1
Sequence:CCGGGCAGTGGACATCAATGGCAATCTCGAGATTGCCATTGATGTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007664.1-626s1c1
Sequence:CCGGGCAGGCAAAGTTCCTGATATACTCGAGTATATCAGGAACTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001792
VALIDATED
CDH2 MISSION shRNA Bacterial Glycerol Stock
cadherin 2, type 1, N-cadherin (neuronal)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-1483s21c1
Sequence:CCGGGTGCAACAGTATACGTTAATACTCGAGTATTAACGTATACTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-2392s21c1
Sequence:CCGGCCAGTGACTATTAAGAGAAATCTCGAGATTTCTCTTAATAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-546s21c1
Sequence:CCGGCGCATTATGCAAGACTGGATTCTCGAGAATCCAGTCTTGCATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-3242s21c1
Sequence:CCGGGCATTCAGAAGCTAGGCTTTACTCGAGTAAAGCCTAGCTTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-2224s21c1
Sequence:CCGGGGAACGCTGCAGATCTATTTACTCGAGTAAATAGATCTGCAGCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001792.3-3007s21c1
Sequence:CCGGCCACCATATGACTCCCTGTTACTCGAGTAACAGGGAGTCATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-2753s1c1
Sequence:CCGGCCACCATATGACTCCCTGTTACTCGAGTAACAGGGAGTCATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-292s1c1
Sequence:CCGGCGCATTATGCAAGACTGGATTCTCGAGAATCCAGTCTTGCATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-695s1c1
Sequence:CCGGCCTCCAATCAACTTGCCAGAACTCGAGTTCTGGCAAGTTGATTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-2138s1c1
Sequence:CCGGCCAGTGACTATTAAGAGAAATCTCGAGATTTCTCTTAATAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001792
VALIDATED
CDH2 MISSION shRNA shRNA Plasmid DNA
cadherin 2, type 1, N-cadherin (neuronal)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-1483s21c1
Sequence:CCGGGTGCAACAGTATACGTTAATACTCGAGTATTAACGTATACTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-2392s21c1
Sequence:CCGGCCAGTGACTATTAAGAGAAATCTCGAGATTTCTCTTAATAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-546s21c1
Sequence:CCGGCGCATTATGCAAGACTGGATTCTCGAGAATCCAGTCTTGCATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-3242s21c1
Sequence:CCGGGCATTCAGAAGCTAGGCTTTACTCGAGTAAAGCCTAGCTTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-2224s21c1
Sequence:CCGGGGAACGCTGCAGATCTATTTACTCGAGTAAATAGATCTGCAGCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001792.3-3007s21c1
Sequence:CCGGCCACCATATGACTCCCTGTTACTCGAGTAACAGGGAGTCATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-2753s1c1
Sequence:CCGGCCACCATATGACTCCCTGTTACTCGAGTAACAGGGAGTCATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-292s1c1
Sequence:CCGGCGCATTATGCAAGACTGGATTCTCGAGAATCCAGTCTTGCATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-695s1c1
Sequence:CCGGCCTCCAATCAACTTGCCAGAACTCGAGTTCTGGCAAGTTGATTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-2138s1c1
Sequence:CCGGCCAGTGACTATTAAGAGAAATCTCGAGATTTCTCTTAATAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001792
VALIDATED
CDH2 MISSION shRNA Lentiviral Transduction Particles
cadherin 2, type 1, N-cadherin (neuronal)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-1483s21c1
Sequence:CCGGGTGCAACAGTATACGTTAATACTCGAGTATTAACGTATACTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-2392s21c1
Sequence:CCGGCCAGTGACTATTAAGAGAAATCTCGAGATTTCTCTTAATAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-546s21c1
Sequence:CCGGCGCATTATGCAAGACTGGATTCTCGAGAATCCAGTCTTGCATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-3242s21c1
Sequence:CCGGGCATTCAGAAGCTAGGCTTTACTCGAGTAAAGCCTAGCTTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001792.3-2224s21c1
Sequence:CCGGGGAACGCTGCAGATCTATTTACTCGAGTAAATAGATCTGCAGCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001792.3-3007s21c1
Sequence:CCGGCCACCATATGACTCCCTGTTACTCGAGTAACAGGGAGTCATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-2753s1c1
Sequence:CCGGCCACCATATGACTCCCTGTTACTCGAGTAACAGGGAGTCATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-292s1c1
Sequence:CCGGCGCATTATGCAAGACTGGATTCTCGAGAATCCAGTCTTGCATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-695s1c1
Sequence:CCGGCCTCCAATCAACTTGCCAGAACTCGAGTTCTGGCAAGTTGATTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001792.2-2138s1c1
Sequence:CCGGCCAGTGACTATTAAGAGAAATCTCGAGATTTCTCTTAATAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks