EMAIL THIS PAGE TO A FRIEND

CDH3

cadherin 3, type 1, P-cadherin (placental)

80 Gene Product Result for
Synonyms: CDHP HJMD PCAD
UniProtKB ID: P22223, B2R6F4, Q05DI6
Gene ID:
Human(1001) Summary: This gene is a classical cadherin from the cadherin superfamily. The encoded protein is a calcium-dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. This gene is located in a six-cadherin cluster in a region on the long arm of chromosome 16 that is involved in loss of heterozygosity events in breast and prostate cancer. In addition, aberrant expression of this protein is observed in cervical adenocarcinomas. Mutations in this gene have been associated with congential hypotrichosis with juvenile macular dystrophy. [provided by RefSeq, Jul 2008]
Mouse(12560) cadherin 3
Rat(116777) cadherin 3
chicken(414845) cadherin 3, type 1, P-cadherin (placental)
cow(281063) cadherin 3, type 1, P-cadherin (placental)
domestic cat(101094895) cadherin 3, type 1, P-cadherin (placental)
dog(611010) cadherin 3, type 1, P-cadherin (placental)
sheep(101111652) cadherin 3, type 1, P-cadherin (placental)
naked mole-rat(101720155) cadherin 3, type 1, P-cadherin (placental)
domestic guinea pig(100725482) cadherin 3, type 1, P-cadherin (placental)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405596 Anti-CDH3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA001767 Anti-CDH3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV45170 Anti-CDH3 antibody produced in rabbit IgG fraction of antiserum pig, horse, mouse, rabbit, human, bovine
immunohistochemistry, western blot pricing
SAB1410055 Anti-CDH3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4500010 Anti-CDH3, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
C1821 Monoclonal Anti-Pan Cadherin antibody produced in mouse clone CH-19, ascites fluid hamster, mouse, rat, bovine, feline, chicken, human, canine, sheep, frog, guinea pig, pig, snake, Psammomys (sand rat), goat, rabbit
immunofluorescence, immunohistochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001793 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024691 MISSION® esiRNA esiRNA human CDH3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001793 Rosetta Predictions human pricing
XM_001076282 Rosetta Predictions rat pricing
XM_226426 Rosetta Predictions rat pricing
NM_001037809 Rosetta Predictions mouse pricing
NM_007665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332561 predicted 1466
2 SASI_Hs01_00022016 predicted 3388
3 SASI_Hs01_00022017 predicted 1319
4 SASI_Hs01_00022018 predicted 3637
5 SASI_Hs01_00022019 predicted 1427
6 SASI_Hs01_00022020 predicted 1395
7 SASI_Hs01_00022021 predicted 3084
8 SASI_Hs01_00022022 predicted 1506
9 SASI_Hs01_00022023 predicted 2429
10 SASI_Hs02_00332562 predicted 2445
11 SASI_Hs01_00022014 predicted 1200
12 SASI_Hs01_00022015 predicted 2760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352676 predicted 595
2 SASI_Rn02_00352677 predicted 2261
3 SASI_Rn02_00352678 predicted 2099
4 SASI_Rn02_00352679 predicted 384
5 SASI_Rn02_00352680 predicted 1487
6 SASI_Rn02_00352681 predicted 1758
7 SASI_Rn02_00352682 predicted 2454
8 SASI_Rn02_00352683 predicted 1183
9 SASI_Rn02_00352684 predicted 235
10 SASI_Rn02_00352685 predicted 2039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383536 predicted 598
2 SASI_Rn02_00383537 predicted 2263
3 SASI_Rn02_00383538 predicted 2093
4 SASI_Rn02_00383539 predicted 393
5 SASI_Rn02_00383540 predicted 1483
6 SASI_Rn02_00383541 predicted 1756
7 SASI_Rn02_00383542 predicted 2461
8 SASI_Rn02_00383543 predicted 1177
9 SASI_Rn02_00383544 predicted 233
10 SASI_Rn02_00383545 predicted 2037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142357 predicted 1856
2 SASI_Mm01_00142358 predicted 2273
3 SASI_Mm01_00142359 predicted 885
4 SASI_Mm01_00142360 predicted 613
5 SASI_Mm02_00289445 predicted 1000
6 SASI_Mm01_00142362 predicted 1190
7 SASI_Mm01_00142363 predicted 549
8 SASI_Mm01_00142364 predicted 1500
9 SASI_Mm01_00142365 predicted 691
10 SASI_Mm01_00142366 predicted 1626
11 SASI_Mm01_00142361 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071463 predicted 1873
2 SASI_Mm01_00071464 predicted 2295
3 SASI_Mm01_00071465 predicted 903
4 SASI_Mm01_00071466 predicted 632
5 SASI_Mm02_00312171 predicted 1018
6 SASI_Mm01_00071468 predicted 1215
7 SASI_Mm01_00071469 predicted 571
8 SASI_Mm01_00071470 predicted 1517
9 SASI_Mm01_00071471 predicted 716
10 SASI_Mm01_00071472 predicted 1642
11 SASI_Mm01_00071467 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007665
CDH3 MISSION shRNA Bacterial Glycerol Stock
cadherin 3, type 1, P-cadherin (placental)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-365s21c1
Sequence:CCGGGTGGGTGATGCCACCAATATTCTCGAGAATATTGGTGGCATCACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-1409s21c1
Sequence:CCGGGGAACTGGTCTGCATCTATACCTCGAGGTATAGATGCAGACCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-1880s21c1
Sequence:CCGGCACGTATGACTTGCATCTTTCCTCGAGGAAAGATGCAAGTCATACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-574s21c1
Sequence:CCGGTTGTCAAGTACGAGCTTTATGCTCGAGCATAAAGCTCGTACTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-2127s1c1
Sequence:CCGGCGCGAGACAATGTCTTCTATTCTCGAGAATAGAAGACATTGTCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007665.1-3014s1c1
Sequence:CCGGCCTGGTACATTTCTCTGACATCTCGAGATGTCAGAGAAATGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-340s1c1
Sequence:CCGGCCGCATCTTAAGGAGACGAAACTCGAGTTTCGTCTCCTTAAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-870s1c1
Sequence:CCGGCGGGAACCATTAGCGTCATATCTCGAGATATGACGCTAATGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-2296s1c1
Sequence:CCGGCCCAGATGAAATCGGGAACTTCTCGAGAAGTTCCCGATTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007665
CDH3 MISSION shRNA shRNA Plasmid DNA
cadherin 3, type 1, P-cadherin (placental)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-365s21c1
Sequence:CCGGGTGGGTGATGCCACCAATATTCTCGAGAATATTGGTGGCATCACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-1409s21c1
Sequence:CCGGGGAACTGGTCTGCATCTATACCTCGAGGTATAGATGCAGACCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-1880s21c1
Sequence:CCGGCACGTATGACTTGCATCTTTCCTCGAGGAAAGATGCAAGTCATACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-574s21c1
Sequence:CCGGTTGTCAAGTACGAGCTTTATGCTCGAGCATAAAGCTCGTACTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-2127s1c1
Sequence:CCGGCGCGAGACAATGTCTTCTATTCTCGAGAATAGAAGACATTGTCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007665.1-3014s1c1
Sequence:CCGGCCTGGTACATTTCTCTGACATCTCGAGATGTCAGAGAAATGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-340s1c1
Sequence:CCGGCCGCATCTTAAGGAGACGAAACTCGAGTTTCGTCTCCTTAAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-870s1c1
Sequence:CCGGCGGGAACCATTAGCGTCATATCTCGAGATATGACGCTAATGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-2296s1c1
Sequence:CCGGCCCAGATGAAATCGGGAACTTCTCGAGAAGTTCCCGATTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007665
CDH3 MISSION shRNA Lentiviral Transduction Particles
cadherin 3, type 1, P-cadherin (placental)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-365s21c1
Sequence:CCGGGTGGGTGATGCCACCAATATTCTCGAGAATATTGGTGGCATCACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-1409s21c1
Sequence:CCGGGGAACTGGTCTGCATCTATACCTCGAGGTATAGATGCAGACCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-1880s21c1
Sequence:CCGGCACGTATGACTTGCATCTTTCCTCGAGGAAAGATGCAAGTCATACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007665.2-574s21c1
Sequence:CCGGTTGTCAAGTACGAGCTTTATGCTCGAGCATAAAGCTCGTACTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-2127s1c1
Sequence:CCGGCGCGAGACAATGTCTTCTATTCTCGAGAATAGAAGACATTGTCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007665.1-3014s1c1
Sequence:CCGGCCTGGTACATTTCTCTGACATCTCGAGATGTCAGAGAAATGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-340s1c1
Sequence:CCGGCCGCATCTTAAGGAGACGAAACTCGAGTTTCGTCTCCTTAAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-870s1c1
Sequence:CCGGCGGGAACCATTAGCGTCATATCTCGAGATATGACGCTAATGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007665.1-2296s1c1
Sequence:CCGGCCCAGATGAAATCGGGAACTTCTCGAGAAGTTCCCGATTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001793
CDH3 MISSION shRNA Bacterial Glycerol Stock
cadherin 3, type 1, P-cadherin (placental)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001793.4-1740s21c1
Sequence:CCGGTCATCGTGACCGACCAGAATGCTCGAGCATTCTGGTCGGTCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001793.4-1419s21c1
Sequence:CCGGTCCCATCCAAACGTATCTTACCTCGAGGTAAGATACGTTTGGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-882s1c1
Sequence:CCGGCCAGAGACTGAATCAGCTCAACTCGAGTTGAGCTGATTCAGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-695s1c1
Sequence:CCGGCAGCTCTGTTTAGCACTGATACTCGAGTATCAGTGCTAAACAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-1191s1c1
Sequence:CCGGCCTACCAGGTACTTCTGTGATCTCGAGATCACAGAAGTACCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-2025s1c1
Sequence:CCGGGCAGTTTGTGAGGAACAACATCTCGAGATGTTGTTCCTCACAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001793
CDH3 MISSION shRNA shRNA Plasmid DNA
cadherin 3, type 1, P-cadherin (placental)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001793.4-1740s21c1
Sequence:CCGGTCATCGTGACCGACCAGAATGCTCGAGCATTCTGGTCGGTCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001793.4-1419s21c1
Sequence:CCGGTCCCATCCAAACGTATCTTACCTCGAGGTAAGATACGTTTGGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-882s1c1
Sequence:CCGGCCAGAGACTGAATCAGCTCAACTCGAGTTGAGCTGATTCAGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-695s1c1
Sequence:CCGGCAGCTCTGTTTAGCACTGATACTCGAGTATCAGTGCTAAACAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-1191s1c1
Sequence:CCGGCCTACCAGGTACTTCTGTGATCTCGAGATCACAGAAGTACCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-2025s1c1
Sequence:CCGGGCAGTTTGTGAGGAACAACATCTCGAGATGTTGTTCCTCACAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001793
CDH3 MISSION shRNA Lentiviral Transduction Particles
cadherin 3, type 1, P-cadherin (placental)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001793.4-1740s21c1
Sequence:CCGGTCATCGTGACCGACCAGAATGCTCGAGCATTCTGGTCGGTCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001793.4-1419s21c1
Sequence:CCGGTCCCATCCAAACGTATCTTACCTCGAGGTAAGATACGTTTGGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-882s1c1
Sequence:CCGGCCAGAGACTGAATCAGCTCAACTCGAGTTGAGCTGATTCAGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-695s1c1
Sequence:CCGGCAGCTCTGTTTAGCACTGATACTCGAGTATCAGTGCTAAACAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-1191s1c1
Sequence:CCGGCCTACCAGGTACTTCTGTGATCTCGAGATCACAGAAGTACCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001793.3-2025s1c1
Sequence:CCGGGCAGTTTGTGAGGAACAACATCTCGAGATGTTGTTCCTCACAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks