EMAIL THIS PAGE TO A FRIEND

CDH4

cadherin 4, type 1, R-cadherin (retinal)

51 Gene Product Result for
Synonyms: CAD4 RCAD
UniProtKB ID: P55283, B3KWB8, G3V1P8, Q2M208, Q5VZ44, Q9BZ05
Gene ID:
Human(1002) Summary: This gene is a classical cadherin from the cadherin superfamily. The encoded protein is a calcium-dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Based on studies in chicken and mouse, this cadherin is thought to play an important role during brain segmentation and neuronal outgrowth. In addition, a role in kidney and muscle development is indicated. Of particular interest are studies showing stable cis-heterodimers of cadherins 2 and 4 in cotransfected cell lines. Previously thought to interact in an exclusively homophilic manner, this is the first evidence of cadherin heterodimerization. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(12561) cadherin 4
Rat(114588) cadherin 4
domestic guinea pig(100720758) cadherin 4, type 1, R-cadherin (retinal)
naked mole-rat(101726465) cadherin 4, type 1, R-cadherin (retinal)
sheep(101122716) cadherin 4, type 1, R-cadherin (retinal)
Zebrafish(30297) cadherin 4, retinal
chicken(419222) cadherin 4, type 1, R-cadherin (retinal)
dog(100685099) cadherin 4, type 1, R-cadherin (retinal)
cow(525796) cadherin 4, type 1, R-cadherin (retinal)
domestic cat(101085708) cadherin 4, type 1, R-cadherin (retinal)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001794 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001794 Rosetta Predictions human pricing
XM_001061943 Rosetta Predictions rat pricing
NM_009867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093138 predicted 1097
2 SASI_Hs01_00093139 predicted 537
3 SASI_Hs01_00093140 predicted 1401
4 SASI_Hs01_00093141 predicted 1636
5 SASI_Hs01_00093142 predicted 413
6 SASI_Hs01_00093143 predicted 1182
7 SASI_Hs01_00093144 predicted 2765
8 SASI_Hs01_00093145 predicted 2735
9 SASI_Hs01_00093147 predicted 2753
10 SASI_Hs02_00332563 predicted 1063
11 SASI_Hs01_00093146 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301850 predicted 806
2 SASI_Rn02_00301851 predicted 552
3 SASI_Rn02_00301852 predicted 2552
4 SASI_Rn02_00301853 predicted 814
5 SASI_Rn02_00301854 predicted 2734
6 SASI_Rn02_00301855 predicted 1309
7 SASI_Rn02_00301856 predicted 1429
8 SASI_Rn02_00301857 predicted 966
9 SASI_Rn02_00301858 predicted 1487
10 SASI_Rn02_00301859 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101766 predicted 1297
2 SASI_Mm01_00101767 predicted 1816
3 SASI_Mm02_00317309 predicted 1300
4 SASI_Mm01_00101768 predicted 904
5 SASI_Mm01_00101769 predicted 793
6 SASI_Mm01_00101770 predicted 1525
7 SASI_Mm01_00101771 predicted 1003
8 SASI_Mm01_00101772 predicted 2226
9 SASI_Mm01_00101774 predicted 798
10 SASI_Mm02_00317310 predicted 1936
11 SASI_Mm01_00101773 predicted 309
12 SASI_Mm01_00101775 predicted 2715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009867
CDH4 MISSION shRNA Bacterial Glycerol Stock
cadherin 4, type 1, R-cadherin (retinal)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-1704s1c1
Sequence:CCGGGCTGCACATCAACACATCCAACTCGAGTTGGATGTGTTGATGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-843s1c1
Sequence:CCGGCGTCATTGACATGAACGACAACTCGAGTTGTCGTTCATGTCAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009867.1-3002s1c1
Sequence:CCGGGCACAGCCCTAACTTGAATTTCTCGAGAAATTCAAGTTAGGGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-433s1c1
Sequence:CCGGGCACACTCTGAACACAAGAAACTCGAGTTTCTTGTGTTCAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-2145s1c1
Sequence:CCGGGTCCAATACATCTGTCATAAACTCGAGTTTATGACAGATGTATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009867.2-707s21c1
Sequence:CCGGTCAGGATCAGGTCGGACAAAGCTCGAGCTTTGTCCGACCTGATCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009867.2-2804s21c1
Sequence:CCGGATCAAGATTACGACTACTTAACTCGAGTTAAGTAGTCGTAATCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009867
CDH4 MISSION shRNA shRNA Plasmid DNA
cadherin 4, type 1, R-cadherin (retinal)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-1704s1c1
Sequence:CCGGGCTGCACATCAACACATCCAACTCGAGTTGGATGTGTTGATGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-843s1c1
Sequence:CCGGCGTCATTGACATGAACGACAACTCGAGTTGTCGTTCATGTCAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009867.1-3002s1c1
Sequence:CCGGGCACAGCCCTAACTTGAATTTCTCGAGAAATTCAAGTTAGGGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-433s1c1
Sequence:CCGGGCACACTCTGAACACAAGAAACTCGAGTTTCTTGTGTTCAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-2145s1c1
Sequence:CCGGGTCCAATACATCTGTCATAAACTCGAGTTTATGACAGATGTATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009867.2-707s21c1
Sequence:CCGGTCAGGATCAGGTCGGACAAAGCTCGAGCTTTGTCCGACCTGATCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009867.2-2804s21c1
Sequence:CCGGATCAAGATTACGACTACTTAACTCGAGTTAAGTAGTCGTAATCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009867
CDH4 MISSION shRNA Lentiviral Transduction Particles
cadherin 4, type 1, R-cadherin (retinal)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-1704s1c1
Sequence:CCGGGCTGCACATCAACACATCCAACTCGAGTTGGATGTGTTGATGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-843s1c1
Sequence:CCGGCGTCATTGACATGAACGACAACTCGAGTTGTCGTTCATGTCAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009867.1-3002s1c1
Sequence:CCGGGCACAGCCCTAACTTGAATTTCTCGAGAAATTCAAGTTAGGGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-433s1c1
Sequence:CCGGGCACACTCTGAACACAAGAAACTCGAGTTTCTTGTGTTCAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009867.1-2145s1c1
Sequence:CCGGGTCCAATACATCTGTCATAAACTCGAGTTTATGACAGATGTATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009867.2-707s21c1
Sequence:CCGGTCAGGATCAGGTCGGACAAAGCTCGAGCTTTGTCCGACCTGATCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009867.2-2804s21c1
Sequence:CCGGATCAAGATTACGACTACTTAACTCGAGTTAAGTAGTCGTAATCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001794
CDH4 MISSION shRNA Bacterial Glycerol Stock
cadherin 4, type 1, R-cadherin (retinal)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-1058s1c1
Sequence:CCGGCCGAGAGAAAGTTCAGCAGTACTCGAGTACTGCTGAACTTTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-797s1c1
Sequence:CCGGCGACCTGTACATCTACGTCATCTCGAGATGACGTAGATGTACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-2120s1c1
Sequence:CCGGCACGTCCATCATCAAAGTCAACTCGAGTTGACTTTGATGATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-1817s1c1
Sequence:CCGGCCAGATCTATCTCATTGACATCTCGAGATGTCAATGAGATAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-122s1c1
Sequence:CCGGTGAAGATGATTACACGGCATTCTCGAGAATGCCGTGTAATCATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001794.2-2305s21c1
Sequence:CCGGACACGAAGCAGCTGCTCATTGCTCGAGCAATGAGCAGCTGCTTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001794.2-592s21c1
Sequence:CCGGTCCGGTCCGACAAAGACAATGCTCGAGCATTGTCTTTGTCGGACCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001794.2-1284s21c1
Sequence:CCGGCCAAACTGGAATGCCGTTTACCTCGAGGTAAACGGCATTCCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001794
CDH4 MISSION shRNA shRNA Plasmid DNA
cadherin 4, type 1, R-cadherin (retinal)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-1058s1c1
Sequence:CCGGCCGAGAGAAAGTTCAGCAGTACTCGAGTACTGCTGAACTTTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-797s1c1
Sequence:CCGGCGACCTGTACATCTACGTCATCTCGAGATGACGTAGATGTACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-2120s1c1
Sequence:CCGGCACGTCCATCATCAAAGTCAACTCGAGTTGACTTTGATGATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-1817s1c1
Sequence:CCGGCCAGATCTATCTCATTGACATCTCGAGATGTCAATGAGATAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-122s1c1
Sequence:CCGGTGAAGATGATTACACGGCATTCTCGAGAATGCCGTGTAATCATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001794.2-2305s21c1
Sequence:CCGGACACGAAGCAGCTGCTCATTGCTCGAGCAATGAGCAGCTGCTTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001794.2-592s21c1
Sequence:CCGGTCCGGTCCGACAAAGACAATGCTCGAGCATTGTCTTTGTCGGACCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001794.2-1284s21c1
Sequence:CCGGCCAAACTGGAATGCCGTTTACCTCGAGGTAAACGGCATTCCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001794
CDH4 MISSION shRNA Lentiviral Transduction Particles
cadherin 4, type 1, R-cadherin (retinal)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-1058s1c1
Sequence:CCGGCCGAGAGAAAGTTCAGCAGTACTCGAGTACTGCTGAACTTTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-797s1c1
Sequence:CCGGCGACCTGTACATCTACGTCATCTCGAGATGACGTAGATGTACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-2120s1c1
Sequence:CCGGCACGTCCATCATCAAAGTCAACTCGAGTTGACTTTGATGATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-1817s1c1
Sequence:CCGGCCAGATCTATCTCATTGACATCTCGAGATGTCAATGAGATAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001794.2-122s1c1
Sequence:CCGGTGAAGATGATTACACGGCATTCTCGAGAATGCCGTGTAATCATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001794.2-2305s21c1
Sequence:CCGGACACGAAGCAGCTGCTCATTGCTCGAGCAATGAGCAGCTGCTTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001794.2-592s21c1
Sequence:CCGGTCCGGTCCGACAAAGACAATGCTCGAGCATTGTCTTTGTCGGACCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001794.2-1284s21c1
Sequence:CCGGCCAAACTGGAATGCCGTTTACCTCGAGGTAAACGGCATTCCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks