EMAIL THIS PAGE TO A FRIEND

CDH5

cadherin 5, type 2 (vascular endothelium)

Synonyms: 7B4 CD144
UniProtKB ID: P33151
Gene ID:
Human(1003) Summary: This gene is a classical cadherin from the cadherin superfamily and is located in a six-cadherin cluster in a region on the long arm of chromosome 16 that is involved in loss of heterozygosity events in breast and prostate cancer. The encoded protein is a calcium-dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Functioning as a classic cadherin by imparting to cells the ability to adhere in a homophilic manner, the protein may play an important role in endothelial cell biology through control of the cohesion and organization of the intercellular junctions. An alternative splice variant has been described but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Mouse(12562) cadherin 5
Rat(307618) cadherin 5
Zebrafish(445471) cadherin 5
chicken(374068) cadherin 5, type 2 (vascular endothelium)
cow(414735) cadherin 5, type 2 (vascular endothelium)
domestic cat(101084501) cadherin 5, type 2 (vascular endothelium)
dog(489775) cadherin 5, type 2 (vascular endothelium)
sheep(101107462) cadherin 5, type 2 (vascular endothelium)
Domestic Rabbit(100301529) cadherin 5, type 2 (vascular endothelium)
naked mole-rat(101706580) cadherin 5, type 2 (vascular endothelium)
domestic guinea pig(100727685) cadherin 5, type 2 (vascular endothelium)
Gene Class: Calcium_Binding
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001795 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABT1760 Anti-phospho-VE-Cadherin (Tyr685) 100 μg, This rabbit polyclonal Anti-phospho-VE-Cadherin (Tyr685), Cat. No. ABT1760 is validated for use in Western Blotting with immunogen peptide blocking for the detection of VE-cadherin tyrosine 685 phosphorylation. pricing
ABT1760-AF488 Anti-phospho-VE-Cadherin (Tyr685) Antibody, Alexa Fluor® 488 Conjugate 100 µL, This rabbit polyclonal Anti-phospho-VE-Cadherin (Tyr685), Alexa Fluor® 488 Conjugate, Cat. No. ABT1760-AF488 is validated for use in Immunocytochemistry for the detection of VE-cadherin Tyr685 phosphorylation. pricing
ABT1760-AF555 Anti-phospho-VE-Cadherin (Tyr685) Antibody, Alexa Fluor® 555 Conjugate 100 µL, This rabbit polyclonal Anti-phospho-VE-Cadherin (Tyr685), Alexa Fluor® 555 Conjugate, Cat. No. ABT1760-AF555 is validated for use in Immunocytochemistry for the detection of VE-cadherin Tyr685 phosphorylation. pricing
MABT129 Anti-VE-Cadherin Antibody (CD144), clone BV9 100 µL, This VE-Cadherin antibody is validated for use in ICC & Enzyme Assay for the detection of the VE-Cadherin protein. pricing
MABT134 Anti-VE-cadherin Antibody, clone BV6 100 µL, This Anti-VE-cadherin Antibody, clone BV6 is validated for use in WB, IC, FC, IH(P) for the detection of VE-cadherin. pricing
MABT886 Anti-VE-Cadherin Antibody, clone Vli37 100 µL, This Anti-VE-Cadherin Antibody, clone Vli37 is validated for use in Western Blotting, Immunohistochemistry (Paraffin), Immunocytochemistry for the detection of VE-Cadherin. pricing
AB1956 Anti-VE-Cadherin Antibody, phospho-specific [Tyr731] 100 µL, Anti-VE-Cadherin Antibody, phospho-specific [Tyr731] is an antibody against VE-Cadherin for use in WB. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001795 Rosetta Predictions human pricing
NM_001107407 Rosetta Predictions rat pricing
NM_009868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100751 predicted 814
2 SASI_Hs01_00100753 predicted 2414
3 SASI_Hs02_00332564 predicted 294
4 SASI_Hs01_00100754 predicted 772
5 SASI_Hs01_00100755 predicted 1608
6 SASI_Hs01_00100756 predicted 561
7 SASI_Hs01_00100757 predicted 393
8 SASI_Hs01_00100758 predicted 1214
9 SASI_Hs01_00100759 predicted 1534
10 SASI_Hs02_00332565 predicted 756
11 SASI_Hs01_00100750 predicted 1654
12 SASI_Hs01_00100752 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228515 predicted 420
2 SASI_Rn02_00228516 predicted 1481
3 SASI_Rn02_00228517 predicted 636
4 SASI_Rn02_00228518 predicted 1055
5 SASI_Rn02_00228519 predicted 591
6 SASI_Rn02_00228520 predicted 1862
7 SASI_Rn02_00228521 predicted 964
8 SASI_Rn02_00228522 predicted 521
9 SASI_Rn02_00228523 predicted 1293
10 SASI_Rn02_00228524 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146231 predicted 1197
2 SASI_Mm01_00146232 predicted 1955
3 SASI_Mm02_00317311 predicted 1419
4 SASI_Mm01_00146233 predicted 770
5 SASI_Mm01_00146234 predicted 1569
6 SASI_Mm01_00146235 predicted 885
7 SASI_Mm01_00146237 predicted 609
8 SASI_Mm01_00146238 predicted 1054
9 SASI_Mm01_00146239 predicted 370
10 SASI_Mm02_00317312 predicted 998
11 SASI_Mm01_00146236 predicted 1185
12 SASI_Mm01_00146240 predicted 2391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001795
CDH5 MISSION shRNA Bacterial Glycerol Stock
cadherin 5, type 2 (vascular endothelium)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001795.3-608s21c1
Sequence:CCGGTCACGCATCGGTTGTTCAATGCTCGAGCATTGAACAACCGATGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001795.3-931s21c1
Sequence:CCGGACCCAGACCAAGTACACATTTCTCGAGAAATGTGTACTTGGTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001795.3-1683s21c1
Sequence:CCGGACGAAACGTGAAGTTCAAATTCTCGAGAATTTGAACTTCACGTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-678s1c1
Sequence:CCGGCGCCTCTGTCATGTACCAAATCTCGAGATTTGGTACATGACAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-345s1c1
Sequence:CCGGGAGTCGCAAGAATGCCAAGTACTCGAGTACTTGGCATTCTTGCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-1695s1c1
Sequence:CCGGCCTCACGGATAATCACGATAACTCGAGTTATCGTGATTATCCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-1622s1c1
Sequence:CCGGCCGCAATAGACAAGGACATAACTCGAGTTATGTCCTTGTCTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-2382s1c1
Sequence:CCGGCGTGGATTACGACTTCCTTAACTCGAGTTAAGGAAGTCGTAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001795
CDH5 MISSION shRNA shRNA Plasmid DNA
cadherin 5, type 2 (vascular endothelium)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001795.3-608s21c1
Sequence:CCGGTCACGCATCGGTTGTTCAATGCTCGAGCATTGAACAACCGATGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001795.3-931s21c1
Sequence:CCGGACCCAGACCAAGTACACATTTCTCGAGAAATGTGTACTTGGTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001795.3-1683s21c1
Sequence:CCGGACGAAACGTGAAGTTCAAATTCTCGAGAATTTGAACTTCACGTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-678s1c1
Sequence:CCGGCGCCTCTGTCATGTACCAAATCTCGAGATTTGGTACATGACAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-345s1c1
Sequence:CCGGGAGTCGCAAGAATGCCAAGTACTCGAGTACTTGGCATTCTTGCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-1695s1c1
Sequence:CCGGCCTCACGGATAATCACGATAACTCGAGTTATCGTGATTATCCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-1622s1c1
Sequence:CCGGCCGCAATAGACAAGGACATAACTCGAGTTATGTCCTTGTCTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-2382s1c1
Sequence:CCGGCGTGGATTACGACTTCCTTAACTCGAGTTAAGGAAGTCGTAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001795
CDH5 MISSION shRNA Lentiviral Transduction Particles
cadherin 5, type 2 (vascular endothelium)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001795.3-608s21c1
Sequence:CCGGTCACGCATCGGTTGTTCAATGCTCGAGCATTGAACAACCGATGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001795.3-931s21c1
Sequence:CCGGACCCAGACCAAGTACACATTTCTCGAGAAATGTGTACTTGGTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001795.3-1683s21c1
Sequence:CCGGACGAAACGTGAAGTTCAAATTCTCGAGAATTTGAACTTCACGTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-678s1c1
Sequence:CCGGCGCCTCTGTCATGTACCAAATCTCGAGATTTGGTACATGACAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-345s1c1
Sequence:CCGGGAGTCGCAAGAATGCCAAGTACTCGAGTACTTGGCATTCTTGCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-1695s1c1
Sequence:CCGGCCTCACGGATAATCACGATAACTCGAGTTATCGTGATTATCCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-1622s1c1
Sequence:CCGGCCGCAATAGACAAGGACATAACTCGAGTTATGTCCTTGTCTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001795.2-2382s1c1
Sequence:CCGGCGTGGATTACGACTTCCTTAACTCGAGTTAAGGAAGTCGTAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009868
CDH5 MISSION shRNA Bacterial Glycerol Stock
cadherin 5, type 2 (vascular endothelium)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-1439s1c1
Sequence:CCGGGCAGGTTTACATTGAAGTCTTCTCGAGAAGACTTCAATGTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-1628s1c1
Sequence:CCGGCCTCATAAACAACCATGACAACTCGAGTTGTCATGGTTGTTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009868.3-2667s1c1
Sequence:CCGGCCCTCCTCATATACACACATACTCGAGTATGTGTGTATATGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-814s1c1
Sequence:CCGGCCGTCTTTACTCAATCCACATCTCGAGATGTGGATTGAGTAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-1663s1c1
Sequence:CCGGCGGTCAAGTATGGGCAGTTTACTCGAGTAAACTGCCCATACTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009868
CDH5 MISSION shRNA shRNA Plasmid DNA
cadherin 5, type 2 (vascular endothelium)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-1439s1c1
Sequence:CCGGGCAGGTTTACATTGAAGTCTTCTCGAGAAGACTTCAATGTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-1628s1c1
Sequence:CCGGCCTCATAAACAACCATGACAACTCGAGTTGTCATGGTTGTTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009868.3-2667s1c1
Sequence:CCGGCCCTCCTCATATACACACATACTCGAGTATGTGTGTATATGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-814s1c1
Sequence:CCGGCCGTCTTTACTCAATCCACATCTCGAGATGTGGATTGAGTAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-1663s1c1
Sequence:CCGGCGGTCAAGTATGGGCAGTTTACTCGAGTAAACTGCCCATACTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009868
CDH5 MISSION shRNA Lentiviral Transduction Particles
cadherin 5, type 2 (vascular endothelium)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-1439s1c1
Sequence:CCGGGCAGGTTTACATTGAAGTCTTCTCGAGAAGACTTCAATGTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-1628s1c1
Sequence:CCGGCCTCATAAACAACCATGACAACTCGAGTTGTCATGGTTGTTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009868.3-2667s1c1
Sequence:CCGGCCCTCCTCATATACACACATACTCGAGTATGTGTGTATATGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-814s1c1
Sequence:CCGGCCGTCTTTACTCAATCCACATCTCGAGATGTGGATTGAGTAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009868.3-1663s1c1
Sequence:CCGGCGGTCAAGTATGGGCAGTTTACTCGAGTAAACTGCCCATACTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks