EMAIL THIS PAGE TO A FRIEND

CDH6

cadherin 6, type 2, K-cadherin (fetal kidney)

145 Gene Product Result for
Synonyms: CAD6 KCAD
UniProtKB ID: P55285, A8K5H5, Q9BWS0
Gene ID:
Human(1004) Summary: This gene encodes a member of the cadherin superfamily. Cadherins are membrane glycoproteins that mediate homophilic cell-cell adhesion and play critical roles in cell differentiation and morphogenesis. The encoded protein is a type II cadherin and may play a role in kidney development as well as endometrium and placenta formation. Decreased expression of this gene may be associated with tumor growth and metastasis. [provided by RefSeq, May 2011]
Mouse(12563) cadherin 6
Rat(25409) cadherin 6
domestic guinea pig(100718489) cadherin 6, type 2, K-cadherin (fetal kidney)
naked mole-rat(101696372) cadherin 6, type 2, K-cadherin (fetal kidney)
sheep(101116091) cadherin 6, type 2, K-cadherin (fetal kidney)
Zebrafish(541393) cadherin 6
cow(537946) cadherin 6, type 2, K-cadherin (fetal kidney)
domestic cat(101100869) cadherin 6, type 2, K-cadherin (fetal kidney)
dog(479376) cadherin 6, type 2, K-cadherin (fetal kidney)
chicken(414842) cadherin 6, type 2, K-cadherin (fetal kidney)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004932 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004932 Rosetta Predictions human pricing
NM_012927 Rosetta Predictions rat pricing
NM_007666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338599 predicted 1023
2 SASI_Hs02_00338600 predicted 1662
3 SASI_Hs01_00131746 predicted 512
4 SASI_Hs01_00131747 predicted 1873
5 SASI_Hs02_00338601 predicted 1484
6 SASI_Hs01_00131749 predicted 1700
7 SASI_Hs01_00131751 predicted 2280
8 SASI_Hs01_00131752 predicted 1504
9 SASI_Hs01_00131753 predicted 949
10 SASI_Hs01_00131754 predicted 1777
11 SASI_Hs01_00131745 predicted 1183
12 SASI_Hs01_00131748 predicted 1268
13 SASI_Hs01_00131750 predicted 2601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051494 predicted 1035
2 SASI_Rn01_00051495 predicted 1297
3 SASI_Rn01_00051496 predicted 1537
4 SASI_Rn01_00051497 predicted 340
5 SASI_Rn02_00260472 predicted 1594
6 SASI_Rn01_00051498 predicted 228
7 SASI_Rn01_00051499 predicted 641
8 SASI_Rn01_00051501 predicted 313
9 SASI_Rn01_00051502 predicted 1449
10 SASI_Rn01_00051503 predicted 2456
11 SASI_Rn01_00051500 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131989 predicted 1063
2 SASI_Mm02_00312172 predicted 309
3 SASI_Mm01_00131990 predicted 510
4 SASI_Mm01_00131991 predicted 1712
5 SASI_Mm02_00312173 predicted 1853
6 SASI_Mm01_00131993 predicted 1410
7 SASI_Mm01_00131995 predicted 2181
8 SASI_Mm01_00131996 predicted 1534
9 SASI_Mm01_00131997 predicted 2214
10 SASI_Mm01_00131998 predicted 836
11 SASI_Mm01_00131992 predicted 320
12 SASI_Mm01_00131994 predicted 1204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007666
CDH6 MISSION shRNA Bacterial Glycerol Stock
cadherin 6, type 2, K-cadherin (fetal kidney)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-1186s1c1
Sequence:CCGGGCCCGGATAAATACGACCATACTCGAGTATGGTCGTATTTATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-2129s1c1
Sequence:CCGGCGGATGTTAGAGATTTCATTACTCGAGTAATGAAATCTCTAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-1595s1c1
Sequence:CCGGCCAGCAGCTCAAACTTTACTACTCGAGTAGTAAAGTTTGAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-1464s1c1
Sequence:CCGGTGCTGAGTTCTATGAAACTTTCTCGAGAAAGTTTCATAGAACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-207s1c1
Sequence:CCGGCGATTATCAGTACGTGGGCAACTCGAGTTGCCCACGTACTGATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007666
CDH6 MISSION shRNA shRNA Plasmid DNA
cadherin 6, type 2, K-cadherin (fetal kidney)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-1186s1c1
Sequence:CCGGGCCCGGATAAATACGACCATACTCGAGTATGGTCGTATTTATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-2129s1c1
Sequence:CCGGCGGATGTTAGAGATTTCATTACTCGAGTAATGAAATCTCTAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-1595s1c1
Sequence:CCGGCCAGCAGCTCAAACTTTACTACTCGAGTAGTAAAGTTTGAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-1464s1c1
Sequence:CCGGTGCTGAGTTCTATGAAACTTTCTCGAGAAAGTTTCATAGAACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-207s1c1
Sequence:CCGGCGATTATCAGTACGTGGGCAACTCGAGTTGCCCACGTACTGATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007666
CDH6 MISSION shRNA Lentiviral Transduction Particles
cadherin 6, type 2, K-cadherin (fetal kidney)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-1186s1c1
Sequence:CCGGGCCCGGATAAATACGACCATACTCGAGTATGGTCGTATTTATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-2129s1c1
Sequence:CCGGCGGATGTTAGAGATTTCATTACTCGAGTAATGAAATCTCTAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-1595s1c1
Sequence:CCGGCCAGCAGCTCAAACTTTACTACTCGAGTAGTAAAGTTTGAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-1464s1c1
Sequence:CCGGTGCTGAGTTCTATGAAACTTTCTCGAGAAAGTTTCATAGAACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007666.1-207s1c1
Sequence:CCGGCGATTATCAGTACGTGGGCAACTCGAGTTGCCCACGTACTGATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004932
VALIDATED
CDH6 MISSION shRNA Bacterial Glycerol Stock
cadherin 6, type 2, K-cadherin (fetal kidney)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004932.2-1965s1c1
Sequence:CCGGGCGGGAATCTTAACTCGGAAACTCGAGTTTCCGAGTTAAGATTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004932.2-1262s1c1
Sequence:CCGGGCTGGATATGTTTGATGTCATCTCGAGATGACATCAAACATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004932.2-615s1c1
Sequence:CCGGGCAGGAGATCTCTTCATTATTCTCGAGAATAATGAAGAGATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004932.2-2370s1c1
Sequence:CCGGGCCATAGAGGACAACAAATTACTCGAGTAATTTGTTGTCCTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004932.2-3131s21c1
Sequence:CCGGTCGGCTCACAAAGAGATAAACCTCGAGGTTTATCTCTTTGTGAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004932.2-701s21c1
Sequence:CCGGCCTTCGAGCTCAAGCTATAAACTCGAGTTTATAGCTTGAGCTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004932.2-1132s21c1
Sequence:CCGGCCCAGAGTACATACCAGTTTACTCGAGTAAACTGGTATGTACTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004932.2-1675s21c1
Sequence:CCGGCACTGCTATGGCACAACATTACTCGAGTAATGTTGTGCCATAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004932
VALIDATED
CDH6 MISSION shRNA shRNA Plasmid DNA
cadherin 6, type 2, K-cadherin (fetal kidney)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004932.2-1965s1c1
Sequence:CCGGGCGGGAATCTTAACTCGGAAACTCGAGTTTCCGAGTTAAGATTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004932.2-1262s1c1
Sequence:CCGGGCTGGATATGTTTGATGTCATCTCGAGATGACATCAAACATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004932.2-615s1c1
Sequence:CCGGGCAGGAGATCTCTTCATTATTCTCGAGAATAATGAAGAGATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004932.2-2370s1c1
Sequence:CCGGGCCATAGAGGACAACAAATTACTCGAGTAATTTGTTGTCCTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004932.2-3131s21c1
Sequence:CCGGTCGGCTCACAAAGAGATAAACCTCGAGGTTTATCTCTTTGTGAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004932.2-701s21c1
Sequence:CCGGCCTTCGAGCTCAAGCTATAAACTCGAGTTTATAGCTTGAGCTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004932.2-1132s21c1
Sequence:CCGGCCCAGAGTACATACCAGTTTACTCGAGTAAACTGGTATGTACTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004932.2-1675s21c1
Sequence:CCGGCACTGCTATGGCACAACATTACTCGAGTAATGTTGTGCCATAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004932
VALIDATED
CDH6 MISSION shRNA Lentiviral Transduction Particles
cadherin 6, type 2, K-cadherin (fetal kidney)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004932.2-1965s1c1
Sequence:CCGGGCGGGAATCTTAACTCGGAAACTCGAGTTTCCGAGTTAAGATTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004932.2-1262s1c1
Sequence:CCGGGCTGGATATGTTTGATGTCATCTCGAGATGACATCAAACATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004932.2-615s1c1
Sequence:CCGGGCAGGAGATCTCTTCATTATTCTCGAGAATAATGAAGAGATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004932.2-2370s1c1
Sequence:CCGGGCCATAGAGGACAACAAATTACTCGAGTAATTTGTTGTCCTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004932.2-3131s21c1
Sequence:CCGGTCGGCTCACAAAGAGATAAACCTCGAGGTTTATCTCTTTGTGAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004932.2-701s21c1
Sequence:CCGGCCTTCGAGCTCAAGCTATAAACTCGAGTTTATAGCTTGAGCTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004932.2-1132s21c1
Sequence:CCGGCCCAGAGTACATACCAGTTTACTCGAGTAAACTGGTATGTACTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004932.2-1675s21c1
Sequence:CCGGCACTGCTATGGCACAACATTACTCGAGTAATGTTGTGCCATAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks