EMAIL THIS PAGE TO A FRIEND

CDH7

cadherin 7, type 2

63 Gene Product Result for
Synonyms: CDH7L1
UniProtKB ID: Q9ULB5, Q9H157
Gene ID:
Human(1005) Summary: This gene is a type II classical cadherin from the cadherin superfamily. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Cadherins mediate cell-cell binding in a homophilic manner, contributing to the sorting of heterogeneous cell types and the maintenance of orderly structures. Alternative splicing in the 5' UTR of this gene yields variant transcripts encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(241201) cadherin 7, type 2
Rat(29162) cadherin 7, type 2
Zebrafish(567704) cadherin 7, type 2
cow(537324) cadherin 7, type 2
Horse(100051783) cadherin 7, type 2
chicken(374007) cadherin 7, type 2
dog(483949) cadherin 7, type 2
domestic cat(101086350) cadherin 7, type 2
sheep(101104029) cadherin 7, type 2
Domestic Rabbit(100339563) cadherin 7, type 2
naked mole-rat(101707520) cadherin 7, type 2
domestic guinea pig(100734889) cadherin 7, type 2
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004361 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157981 MISSION® esiRNA esiRNA human CDH7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004361 Rosetta Predictions human pricing
NM_033646 Rosetta Predictions human pricing
NM_001012737 Rosetta Predictions rat pricing
NM_172853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213153 predicted 1171
2 SASI_Hs02_00337428 predicted 1505
3 SASI_Hs02_00337429 predicted 1519
4 SASI_Hs01_00213154 predicted 1680
5 SASI_Hs01_00213156 predicted 1826
6 SASI_Hs01_00213157 predicted 2173
7 SASI_Hs01_00213158 predicted 1814
8 SASI_Hs01_00213159 predicted 1424
9 SASI_Hs01_00213160 predicted 1242
10 SASI_Hs02_00337430 predicted 1187
11 SASI_Hs01_00213155 predicted 1802
12 SASI_Hs01_00213161 predicted 1158
13 SASI_Hs01_00213162 predicted 2490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149454 predicted 1075
2 SASI_Hs02_00361457 predicted 1403
3 SASI_Hs02_00361458 predicted 1414
4 SASI_Hs01_00149455 predicted 1572
5 SASI_Hs01_00149457 predicted 1729
6 SASI_Hs01_00149458 predicted 2070
7 SASI_Hs01_00149459 predicted 1716
8 SASI_Hs01_00149460 predicted 1328
9 SASI_Hs01_00149461 predicted 1138
10 SASI_Hs02_00361459 predicted 1087
11 SASI_Hs01_00149456 predicted 1696
12 SASI_Hs01_00149462 predicted 1059
13 SASI_Hs01_00149463 predicted 2390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079386 predicted 1000
2 SASI_Rn01_00079387 predicted 749
3 SASI_Rn01_00079388 predicted 1664
4 SASI_Rn01_00079389 predicted 1327
5 SASI_Rn01_00079390 predicted 303
6 SASI_Rn01_00079391 predicted 1407
7 SASI_Rn01_00079392 predicted 786
8 SASI_Rn01_00079393 predicted 1565
9 SASI_Rn01_00079394 predicted 1865
10 SASI_Rn01_00079395 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080269 predicted 1099
2 SASI_Mm02_00344800 predicted 1278
3 SASI_Mm02_00344801 predicted 2608
4 SASI_Mm01_00080270 predicted 1672
5 SASI_Mm01_00080271 predicted 1919
6 SASI_Mm01_00080273 predicted 1346
7 SASI_Mm02_00344802 predicted 729
8 SASI_Mm01_00080275 predicted 1518
9 SASI_Mm01_00080276 predicted 1140
10 SASI_Mm01_00080277 predicted 801
11 SASI_Mm01_00080272 predicted 1435
12 SASI_Mm01_00080274 predicted 2544
13 SASI_Mm01_00080278 predicted 760
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004361
CDH7 MISSION shRNA Bacterial Glycerol Stock
cadherin 7, type 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000448164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004361.2-1086s21c1
Sequence:CCGGAGAGGCTAAAGACCAGTATTTCTCGAGAAATACTGGTCTTTAGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-1178s1c1
Sequence:CCGGCCCTAACTGATGTCAACGATACTCGAGTATCGTTGACATCAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-1270s1c1
Sequence:CCGGGCCAGAATTAAAGCTGCTGATCTCGAGATCAGCAGCTTTAATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-991s1c1
Sequence:CCGGGCCAGAGTGGTCTACAGTATTCTCGAGAATACTGTAGACCACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-2307s1c1
Sequence:CCGGCGTCACTATGAGAAGACGGAACTCGAGTTCCGTCTTCTCATAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-519s1c1
Sequence:CCGGGTCCAGATCAAAGCCCTATTTCTCGAGAAATAGGGCTTTGATCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004361
CDH7 MISSION shRNA shRNA Plasmid DNA
cadherin 7, type 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000448164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004361.2-1086s21c1
Sequence:CCGGAGAGGCTAAAGACCAGTATTTCTCGAGAAATACTGGTCTTTAGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-1178s1c1
Sequence:CCGGCCCTAACTGATGTCAACGATACTCGAGTATCGTTGACATCAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-1270s1c1
Sequence:CCGGGCCAGAATTAAAGCTGCTGATCTCGAGATCAGCAGCTTTAATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-991s1c1
Sequence:CCGGGCCAGAGTGGTCTACAGTATTCTCGAGAATACTGTAGACCACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-2307s1c1
Sequence:CCGGCGTCACTATGAGAAGACGGAACTCGAGTTCCGTCTTCTCATAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-519s1c1
Sequence:CCGGGTCCAGATCAAAGCCCTATTTCTCGAGAAATAGGGCTTTGATCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004361
CDH7 MISSION shRNA Lentiviral Transduction Particles
cadherin 7, type 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000448164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004361.2-1086s21c1
Sequence:CCGGAGAGGCTAAAGACCAGTATTTCTCGAGAAATACTGGTCTTTAGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-1178s1c1
Sequence:CCGGCCCTAACTGATGTCAACGATACTCGAGTATCGTTGACATCAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-1270s1c1
Sequence:CCGGGCCAGAATTAAAGCTGCTGATCTCGAGATCAGCAGCTTTAATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-991s1c1
Sequence:CCGGGCCAGAGTGGTCTACAGTATTCTCGAGAATACTGTAGACCACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-2307s1c1
Sequence:CCGGCGTCACTATGAGAAGACGGAACTCGAGTTCCGTCTTCTCATAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004361.2-519s1c1
Sequence:CCGGGTCCAGATCAAAGCCCTATTTCTCGAGAAATAGGGCTTTGATCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172853
CDH7 MISSION shRNA Bacterial Glycerol Stock
cadherin 7, type 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172853.1-2868s1c1
Sequence:CCGGGCCCTTGTGAAACATTCATTACTCGAGTAATGAATGTTTCACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-1754s1c1
Sequence:CCGGGCCATTACTATACTGGATATTCTCGAGAATATCCAGTATAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-2200s1c1
Sequence:CCGGCCTGACACTATTGGTGCTGATCTCGAGATCAGCACCAATAGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-1043s1c1
Sequence:CCGGGCAAAGGATATGGTTGGTCAACTCGAGTTGACCAACCATATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-1908s1c1
Sequence:CCGGGCTTAACAACAGACATGACAACTCGAGTTGTCATGTCTGTTGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172853
CDH7 MISSION shRNA shRNA Plasmid DNA
cadherin 7, type 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172853.1-2868s1c1
Sequence:CCGGGCCCTTGTGAAACATTCATTACTCGAGTAATGAATGTTTCACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-1754s1c1
Sequence:CCGGGCCATTACTATACTGGATATTCTCGAGAATATCCAGTATAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-2200s1c1
Sequence:CCGGCCTGACACTATTGGTGCTGATCTCGAGATCAGCACCAATAGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-1043s1c1
Sequence:CCGGGCAAAGGATATGGTTGGTCAACTCGAGTTGACCAACCATATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-1908s1c1
Sequence:CCGGGCTTAACAACAGACATGACAACTCGAGTTGTCATGTCTGTTGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172853
CDH7 MISSION shRNA Lentiviral Transduction Particles
cadherin 7, type 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172853.1-2868s1c1
Sequence:CCGGGCCCTTGTGAAACATTCATTACTCGAGTAATGAATGTTTCACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-1754s1c1
Sequence:CCGGGCCATTACTATACTGGATATTCTCGAGAATATCCAGTATAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-2200s1c1
Sequence:CCGGCCTGACACTATTGGTGCTGATCTCGAGATCAGCACCAATAGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-1043s1c1
Sequence:CCGGGCAAAGGATATGGTTGGTCAACTCGAGTTGACCAACCATATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172853.1-1908s1c1
Sequence:CCGGGCTTAACAACAGACATGACAACTCGAGTTGTCATGTCTGTTGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks