EMAIL THIS PAGE TO A FRIEND

CDH8

cadherin 8, type 2

84 Gene Product Result for
Synonyms: Nbla04261
UniProtKB ID: P55286, B3KWC1, Q14DC6, Q9ULB2
Gene ID:
Human(1006) Summary: This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed in brain and is putatively involved in synaptic adhesion, axon outgrowth and guidance. [provided by RefSeq, Jul 2008]
Mouse(12564) cadherin 8
Rat(84408) cadherin 8
naked mole-rat(101709808) cadherin 8, type 2
sheep(101106707) cadherin 8, type 2
Domestic Rabbit(100348982) cadherin 8, type 2
Zebrafish(564205) cadherin 8, type 2
cow(521039) cadherin 8, type 2
Horse(100052663) cadherin 8, type 2
domestic cat(101094809) cadherin 8, type 2
chicken(427553) cadherin 8, type 2
dog(489777) cadherin 8, type 2
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001796 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001796 Rosetta Predictions human pricing
NM_053393 Rosetta Predictions rat pricing
NM_001039154 Rosetta Predictions mouse pricing
NM_007667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130161 predicted 736
2 SASI_Hs01_00130162 predicted 1431
3 SASI_Hs01_00130163 predicted 1876
4 SASI_Hs01_00130164 predicted 2492
5 SASI_Hs01_00130165 predicted 1975
6 SASI_Hs01_00130166 predicted 1398
7 SASI_Hs01_00130167 predicted 2462
8 SASI_Hs01_00130168 predicted 481
9 SASI_Hs01_00130169 predicted 2048
10 SASI_Hs01_00130170 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265890 predicted 2567
2 SASI_Rn01_00079356 predicted 2751
3 SASI_Rn02_00265891 predicted 1974
4 SASI_Rn01_00079357 predicted 2325
5 SASI_Rn01_00079358 predicted 2690
6 SASI_Rn01_00079359 predicted 1102
7 SASI_Rn01_00079360 predicted 762
8 SASI_Rn01_00079362 predicted 2009
9 SASI_Rn02_00265892 predicted 1807
10 SASI_Rn01_00079364 predicted 2228
11 SASI_Rn01_00079361 predicted 858
12 SASI_Rn01_00079363 predicted 1583
13 SASI_Rn01_00079365 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113800 predicted 2015
2 SASI_Mm01_00113801 predicted 1302
3 SASI_Mm01_00113802 predicted 1182
4 SASI_Mm01_00113803 predicted 2101
5 SASI_Mm01_00113804 predicted 1723
6 SASI_Mm01_00113806 predicted 806
7 SASI_Mm01_00113807 predicted 1403
8 SASI_Mm01_00113808 predicted 1539
9 SASI_Mm01_00113809 predicted 2179
10 SASI_Mm02_00289878 predicted 1756
11 SASI_Mm01_00113805 predicted 1877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169402 predicted 2023
2 SASI_Mm01_00169403 predicted 1301
3 SASI_Mm01_00169404 predicted 1176
4 SASI_Mm01_00169405 predicted 2104
5 SASI_Mm01_00169406 predicted 1725
6 SASI_Mm01_00169408 predicted 807
7 SASI_Mm01_00169409 predicted 1411
8 SASI_Mm01_00169410 predicted 1534
9 SASI_Mm01_00169411 predicted 2178
10 SASI_Mm02_00312174 predicted 1759
11 SASI_Mm01_00169407 predicted 1885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007667
CDH8 MISSION shRNA Bacterial Glycerol Stock
cadherin 8, type 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007667.1-2656s1c1
Sequence:CCGGGCACTGAGCATTCTGTAATATCTCGAGATATTACAGAATGCTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-1719s1c1
Sequence:CCGGGCATCCGAATATGAGGCATTTCTCGAGAAATGCCTCATATTCGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-543s1c1
Sequence:CCGGGCTGGCACAATCTTTCAAATACTCGAGTATTTGAAAGATTGTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-1762s1c1
Sequence:CCGGGCCAAGTAATTCAAACAGTAACTCGAGTTACTGTTTGAATTACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-2319s1c1
Sequence:CCGGCGTAAGGATATTAAACCAGATCTCGAGATCTGGTTTAATATCCTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007667
CDH8 MISSION shRNA shRNA Plasmid DNA
cadherin 8, type 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007667.1-2656s1c1
Sequence:CCGGGCACTGAGCATTCTGTAATATCTCGAGATATTACAGAATGCTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-1719s1c1
Sequence:CCGGGCATCCGAATATGAGGCATTTCTCGAGAAATGCCTCATATTCGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-543s1c1
Sequence:CCGGGCTGGCACAATCTTTCAAATACTCGAGTATTTGAAAGATTGTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-1762s1c1
Sequence:CCGGGCCAAGTAATTCAAACAGTAACTCGAGTTACTGTTTGAATTACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-2319s1c1
Sequence:CCGGCGTAAGGATATTAAACCAGATCTCGAGATCTGGTTTAATATCCTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007667
CDH8 MISSION shRNA Lentiviral Transduction Particles
cadherin 8, type 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007667.1-2656s1c1
Sequence:CCGGGCACTGAGCATTCTGTAATATCTCGAGATATTACAGAATGCTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-1719s1c1
Sequence:CCGGGCATCCGAATATGAGGCATTTCTCGAGAAATGCCTCATATTCGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-543s1c1
Sequence:CCGGGCTGGCACAATCTTTCAAATACTCGAGTATTTGAAAGATTGTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-1762s1c1
Sequence:CCGGGCCAAGTAATTCAAACAGTAACTCGAGTTACTGTTTGAATTACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007667.1-2319s1c1
Sequence:CCGGCGTAAGGATATTAAACCAGATCTCGAGATCTGGTTTAATATCCTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001796
CDH8 MISSION shRNA Bacterial Glycerol Stock
cadherin 8, type 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-1784s1c1
Sequence:CCGGGCCAAGTCATTCAAACTGTTACTCGAGTAACAGTTTGAATGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-1948s1c1
Sequence:CCGGCGCCAGAAGCAAGAAGTCTATCTCGAGATAGACTTCTTGCTTCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-565s1c1
Sequence:CCGGGCTGGGACCATATTTCAAATACTCGAGTATTTGAAATATGGTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-1462s1c1
Sequence:CCGGGCTGCTCTAAACTCCGTGATTCTCGAGAATCACGGAGTTTAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-343s1c1
Sequence:CCGGCCGATGAATCAGTCTCAAGTTCTCGAGAACTTGAGACTGATTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001796.2-1509s21c1
Sequence:CCGGTATCACTTCCAGTCCTATAAGCTCGAGCTTATAGGACTGGAAGTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001796.2-1867s21c1
Sequence:CCGGATGGTCAACAATCCGAATTTCCTCGAGGAAATTCGGATTGTTGACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001796
CDH8 MISSION shRNA shRNA Plasmid DNA
cadherin 8, type 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-1784s1c1
Sequence:CCGGGCCAAGTCATTCAAACTGTTACTCGAGTAACAGTTTGAATGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-1948s1c1
Sequence:CCGGCGCCAGAAGCAAGAAGTCTATCTCGAGATAGACTTCTTGCTTCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-565s1c1
Sequence:CCGGGCTGGGACCATATTTCAAATACTCGAGTATTTGAAATATGGTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-1462s1c1
Sequence:CCGGGCTGCTCTAAACTCCGTGATTCTCGAGAATCACGGAGTTTAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-343s1c1
Sequence:CCGGCCGATGAATCAGTCTCAAGTTCTCGAGAACTTGAGACTGATTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001796.2-1509s21c1
Sequence:CCGGTATCACTTCCAGTCCTATAAGCTCGAGCTTATAGGACTGGAAGTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001796.2-1867s21c1
Sequence:CCGGATGGTCAACAATCCGAATTTCCTCGAGGAAATTCGGATTGTTGACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001796
CDH8 MISSION shRNA Lentiviral Transduction Particles
cadherin 8, type 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-1784s1c1
Sequence:CCGGGCCAAGTCATTCAAACTGTTACTCGAGTAACAGTTTGAATGACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-1948s1c1
Sequence:CCGGCGCCAGAAGCAAGAAGTCTATCTCGAGATAGACTTCTTGCTTCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-565s1c1
Sequence:CCGGGCTGGGACCATATTTCAAATACTCGAGTATTTGAAATATGGTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-1462s1c1
Sequence:CCGGGCTGCTCTAAACTCCGTGATTCTCGAGAATCACGGAGTTTAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001796.2-343s1c1
Sequence:CCGGCCGATGAATCAGTCTCAAGTTCTCGAGAACTTGAGACTGATTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001796.2-1509s21c1
Sequence:CCGGTATCACTTCCAGTCCTATAAGCTCGAGCTTATAGGACTGGAAGTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001796.2-1867s21c1
Sequence:CCGGATGGTCAACAATCCGAATTTCCTCGAGGAAATTCGGATTGTTGACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)