EMAIL THIS PAGE TO A FRIEND

CDH9

cadherin 9, type 2 (T1-cadherin)

94 Gene Product Result for
UniProtKB ID: Q9ULB4, Q3B7I5
Gene ID:
Human(1007) Summary: This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
Mouse(12565) cadherin 9
Rat(29163) cadherin 9
chicken(428487) cadherin 9, type 2 (T1-cadherin)
cow(541188) cadherin 9, type 2 (T1-cadherin)
domestic cat(101101112) cadherin 9, type 2 (T1-cadherin)
dog(489245) cadherin 9, type 2 (T1-cadherin)
sheep(101117108) cadherin 9, type 2 (T1-cadherin)
naked mole-rat(101698092) cadherin 9, type 2 (T1-cadherin)
domestic guinea pig(100717894) cadherin 9, type 2 (T1-cadherin)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016279 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016279 Rosetta Predictions human pricing
XM_001058100 Rosetta Predictions rat pricing
XM_226861 Rosetta Predictions rat pricing
NM_009869 Rosetta Predictions mouse pricing
XM_986179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218813 predicted 1510
2 SASI_Hs01_00218814 predicted 1750
3 SASI_Hs01_00218815 predicted 2405
4 SASI_Hs01_00218816 predicted 197
5 SASI_Hs01_00218817 predicted 1131
6 SASI_Hs02_00349192 predicted 1547
7 SASI_Hs01_00218818 predicted 1674
8 SASI_Hs01_00218819 predicted 2119
9 SASI_Hs01_00218820 predicted 1061
10 SASI_Hs02_00349193 predicted 2222
11 SASI_Hs01_00218812 predicted 2541
12 SASI_Hs01_00218821 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288584 predicted 313
2 SASI_Rn02_00288585 predicted 1706
3 SASI_Rn02_00288586 predicted 1418
4 SASI_Rn02_00288587 predicted 1400
5 SASI_Rn02_00288588 predicted 452
6 SASI_Rn02_00288589 predicted 1587
7 SASI_Rn02_00288590 predicted 809
8 SASI_Rn02_00288591 predicted 2055
9 SASI_Rn02_00288592 predicted 290
10 SASI_Rn02_00288593 predicted 1845
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383925 predicted 313
2 SASI_Rn02_00383926 predicted 1698
3 SASI_Rn02_00383927 predicted 1412
4 SASI_Rn02_00383928 predicted 1406
5 SASI_Rn02_00383929 predicted 452
6 SASI_Rn02_00383930 predicted 1589
7 SASI_Rn02_00383931 predicted 802
8 SASI_Rn02_00383932 predicted 2060
9 SASI_Rn02_00383933 predicted 298
10 SASI_Rn02_00383934 predicted 1840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317313 predicted 807
2 SASI_Mm02_00317314 predicted 2212
3 SASI_Mm02_00317315 predicted 2020
4 SASI_Mm02_00317316 predicted 1532
5 SASI_Mm02_00317317 predicted 1463
6 SASI_Mm02_00317318 predicted 684
7 SASI_Mm02_00317319 predicted 1896
8 SASI_Mm02_00317320 predicted 1549
9 SASI_Mm02_00317321 predicted 1447
10 SASI_Mm02_00317322 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250501 predicted 860
2 SASI_Mm01_00250502 predicted 1578
3 SASI_Mm01_00250503 predicted 1510
4 SASI_Mm01_00250504 predicted 1453
5 SASI_Mm01_00250505 predicted 1066
6 SASI_Mm01_00250506 predicted 744
7 SASI_Mm01_00250507 predicted 1601
8 SASI_Mm01_00250508 predicted 750
9 SASI_Mm01_00250509 predicted 334
10 SASI_Mm01_00250510 predicted 1201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016279
CDH9 MISSION shRNA Bacterial Glycerol Stock
cadherin 9, type 2 (T1-cadherin)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016279.3-2118s21c1
Sequence:CCGGACGATGTCCGGGACAACATTGCTCGAGCAATGTTGTCCCGGACATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016279.3-2520s21c1
Sequence:CCGGATGATAGTGACCGAGACTAAGCTCGAGCTTAGTCTCGGTCACTATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-1839s1c1
Sequence:CCGGGCACCTACTTATTGCCGATTTCTCGAGAAATCGGCAATAAGTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-2426s1c1
Sequence:CCGGGCTGATTGTAACCAAGATTATCTCGAGATAATCTTGGTTACAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-1423s1c1
Sequence:CCGGGCATACTGATATGGACCGTATCTCGAGATACGGTCCATATCAGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-1533s1c1
Sequence:CCGGCCACAGAAATAAGTAACCCAACTCGAGTTGGGTTACTTATTTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-443s1c1
Sequence:CCGGGCTGGCAGTCTATTTGTTATACTCGAGTATAACAAATAGACTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016279
CDH9 MISSION shRNA shRNA Plasmid DNA
cadherin 9, type 2 (T1-cadherin)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016279.3-2118s21c1
Sequence:CCGGACGATGTCCGGGACAACATTGCTCGAGCAATGTTGTCCCGGACATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016279.3-2520s21c1
Sequence:CCGGATGATAGTGACCGAGACTAAGCTCGAGCTTAGTCTCGGTCACTATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-1839s1c1
Sequence:CCGGGCACCTACTTATTGCCGATTTCTCGAGAAATCGGCAATAAGTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-2426s1c1
Sequence:CCGGGCTGATTGTAACCAAGATTATCTCGAGATAATCTTGGTTACAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-1423s1c1
Sequence:CCGGGCATACTGATATGGACCGTATCTCGAGATACGGTCCATATCAGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-1533s1c1
Sequence:CCGGCCACAGAAATAAGTAACCCAACTCGAGTTGGGTTACTTATTTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-443s1c1
Sequence:CCGGGCTGGCAGTCTATTTGTTATACTCGAGTATAACAAATAGACTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016279
CDH9 MISSION shRNA Lentiviral Transduction Particles
cadherin 9, type 2 (T1-cadherin)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016279.3-2118s21c1
Sequence:CCGGACGATGTCCGGGACAACATTGCTCGAGCAATGTTGTCCCGGACATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016279.3-2520s21c1
Sequence:CCGGATGATAGTGACCGAGACTAAGCTCGAGCTTAGTCTCGGTCACTATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-1839s1c1
Sequence:CCGGGCACCTACTTATTGCCGATTTCTCGAGAAATCGGCAATAAGTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-2426s1c1
Sequence:CCGGGCTGATTGTAACCAAGATTATCTCGAGATAATCTTGGTTACAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-1423s1c1
Sequence:CCGGGCATACTGATATGGACCGTATCTCGAGATACGGTCCATATCAGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-1533s1c1
Sequence:CCGGCCACAGAAATAAGTAACCCAACTCGAGTTGGGTTACTTATTTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016279.2-443s1c1
Sequence:CCGGGCTGGCAGTCTATTTGTTATACTCGAGTATAACAAATAGACTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009869
CDH9 MISSION shRNA Bacterial Glycerol Stock
cadherin 9, type 2 (T1-cadherin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-629s21c1
Sequence:CCGGACCCGGAATCAGGCATAATAACTCGAGTTATTATGCCTGATTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-1708s21c1
Sequence:CCGGTTCGACAATGATTATCCTATTCTCGAGAATAGGATAATCATTGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-522s21c1
Sequence:CCGGTACGTCTGTTATACAAGTAACCTCGAGGTTACTTGTATAACAGACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009869.1-2573s21c1
Sequence:CCGGTTCACCCTCTTTGCCTAATAACTCGAGTTATTAGGCAAAGAGGGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-1866s21c1
Sequence:CCGGCGTCATCCTGCTTACTCTAATCTCGAGATTAGAGTAAGCAGGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009869
CDH9 MISSION shRNA shRNA Plasmid DNA
cadherin 9, type 2 (T1-cadherin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-629s21c1
Sequence:CCGGACCCGGAATCAGGCATAATAACTCGAGTTATTATGCCTGATTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-1708s21c1
Sequence:CCGGTTCGACAATGATTATCCTATTCTCGAGAATAGGATAATCATTGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-522s21c1
Sequence:CCGGTACGTCTGTTATACAAGTAACCTCGAGGTTACTTGTATAACAGACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009869.1-2573s21c1
Sequence:CCGGTTCACCCTCTTTGCCTAATAACTCGAGTTATTAGGCAAAGAGGGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-1866s21c1
Sequence:CCGGCGTCATCCTGCTTACTCTAATCTCGAGATTAGAGTAAGCAGGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009869
CDH9 MISSION shRNA Lentiviral Transduction Particles
cadherin 9, type 2 (T1-cadherin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-629s21c1
Sequence:CCGGACCCGGAATCAGGCATAATAACTCGAGTTATTATGCCTGATTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-1708s21c1
Sequence:CCGGTTCGACAATGATTATCCTATTCTCGAGAATAGGATAATCATTGTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-522s21c1
Sequence:CCGGTACGTCTGTTATACAAGTAACCTCGAGGTTACTTGTATAACAGACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009869.1-2573s21c1
Sequence:CCGGTTCACCCTCTTTGCCTAATAACTCGAGTTATTAGGCAAAGAGGGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009869.1-1866s21c1
Sequence:CCGGCGTCATCCTGCTTACTCTAATCTCGAGATTAGAGTAAGCAGGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)