EMAIL THIS PAGE TO A FRIEND

CDHR1

cadherin-related family member 1

Synonyms: CORD15 PCDH21 PRCAD RP65
UniProtKB ID: Q96JP9, Q69YZ8, Q8IXY5
Gene ID:
Human(92211) Summary: This gene belongs to the cadherin superfamily of calcium-dependent cell adhesion molecules. The encoded protein is a photoreceptor-specific cadherin that plays a role in outer segment disc morphogenesis. Mutations in this gene are associated with inherited retinal dystrophies. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2013]
Mouse(170677) cadherin-related family member 1
Rat(93662) cadherin-related family member 1
domestic guinea pig(100725724) cadherin-related family member 1
naked mole-rat(101706617) cadherin-related family member 1
sheep(101113303) cadherin-related family member 1
Domestic Rabbit(100357010) cadherin-related family member 1
chicken(414847) cadherin-related family member 1
cow(281996) cadherin-related family member 1
domestic cat(101084231) cadherin-related family member 1
dog(610781) cadherin-related family member 1
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033100 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033100 Rosetta Predictions human pricing
NM_053572 Rosetta Predictions rat pricing
NM_130878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209870 predicted 2550
2 SASI_Hs02_00360802 predicted 1877
3 SASI_Hs01_00209872 predicted 1660
4 SASI_Hs01_00209873 predicted 1621
5 SASI_Hs02_00360803 predicted 1631
6 SASI_Hs01_00209876 predicted 1423
7 SASI_Hs01_00209877 predicted 692
8 SASI_Hs01_00209878 predicted 947
9 SASI_Hs01_00209879 predicted 2182
10 SASI_Hs02_00360804 predicted 398
11 SASI_Hs01_00209871 predicted 946
12 SASI_Hs01_00209874 predicted 318
13 SASI_Hs01_00209875 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030238 predicted 2760
2 SASI_Rn01_00030239 predicted 547
3 SASI_Rn01_00030240 predicted 1334
4 SASI_Rn01_00030241 predicted 1273
5 SASI_Rn01_00030242 predicted 2447
6 SASI_Rn02_00266235 predicted 1565
7 SASI_Rn01_00030243 predicted 387
8 SASI_Rn02_00266236 predicted 2287
9 SASI_Rn01_00030244 predicted 1606
10 SASI_Rn01_00030245 predicted 1042
11 SASI_Rn01_00030246 predicted 954
12 SASI_Rn01_00030247 predicted 2098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045492 predicted 2417
2 SASI_Mm01_00045493 predicted 2568
3 SASI_Mm01_00045494 predicted 2164
4 SASI_Mm01_00045495 predicted 1786
5 SASI_Mm01_00045496 predicted 2256
6 SASI_Mm01_00045497 predicted 1305
7 SASI_Mm01_00045498 predicted 2730
8 SASI_Mm02_00338304 predicted 2291
9 SASI_Mm01_00045499 predicted 2720
10 SASI_Mm01_00045500 predicted 2061
11 SASI_Mm01_00045501 predicted 1255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033100
CDHR1 MISSION shRNA Bacterial Glycerol Stock
cadherin-related family member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-2290s1c1
Sequence:CCGGGCTACCAAGTTCATGCTCAAACTCGAGTTTGAGCATGAACTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-1299s1c1
Sequence:CCGGGTCCAAAGTATTAACCTTCAACTCGAGTTGAAGGTTAATACTTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-1725s1c1
Sequence:CCGGGTTTGGAAAGAGCGTTCAGAACTCGAGTTCTGAACGCTCTTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-697s1c1
Sequence:CCGGACGGTCAATGTGGAGGATGTTCTCGAGAACATCCTCCACATTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-1849s1c1
Sequence:CCGGGCCAACGTGTTCGACATCAATCTCGAGATTGATGTCGAACACGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033100.2-1148s21c1
Sequence:CCGGACCACCCGCCAACATTCTATGCTCGAGCATAGAATGTTGGCGGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033100.2-260s21c1
Sequence:CCGGCTCACGTATACACCCTGAATGCTCGAGCATTCAGGGTGTATACGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033100
CDHR1 MISSION shRNA shRNA Plasmid DNA
cadherin-related family member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-2290s1c1
Sequence:CCGGGCTACCAAGTTCATGCTCAAACTCGAGTTTGAGCATGAACTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-1299s1c1
Sequence:CCGGGTCCAAAGTATTAACCTTCAACTCGAGTTGAAGGTTAATACTTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-1725s1c1
Sequence:CCGGGTTTGGAAAGAGCGTTCAGAACTCGAGTTCTGAACGCTCTTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-697s1c1
Sequence:CCGGACGGTCAATGTGGAGGATGTTCTCGAGAACATCCTCCACATTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-1849s1c1
Sequence:CCGGGCCAACGTGTTCGACATCAATCTCGAGATTGATGTCGAACACGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033100.2-1148s21c1
Sequence:CCGGACCACCCGCCAACATTCTATGCTCGAGCATAGAATGTTGGCGGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033100.2-260s21c1
Sequence:CCGGCTCACGTATACACCCTGAATGCTCGAGCATTCAGGGTGTATACGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033100
CDHR1 MISSION shRNA Lentiviral Transduction Particles
cadherin-related family member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-2290s1c1
Sequence:CCGGGCTACCAAGTTCATGCTCAAACTCGAGTTTGAGCATGAACTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-1299s1c1
Sequence:CCGGGTCCAAAGTATTAACCTTCAACTCGAGTTGAAGGTTAATACTTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-1725s1c1
Sequence:CCGGGTTTGGAAAGAGCGTTCAGAACTCGAGTTCTGAACGCTCTTTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-697s1c1
Sequence:CCGGACGGTCAATGTGGAGGATGTTCTCGAGAACATCCTCCACATTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033100.1-1849s1c1
Sequence:CCGGGCCAACGTGTTCGACATCAATCTCGAGATTGATGTCGAACACGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033100.2-1148s21c1
Sequence:CCGGACCACCCGCCAACATTCTATGCTCGAGCATAGAATGTTGGCGGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033100.2-260s21c1
Sequence:CCGGCTCACGTATACACCCTGAATGCTCGAGCATTCAGGGTGTATACGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130878
CDHR1 MISSION shRNA Bacterial Glycerol Stock
cadherin-related family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130878.2-2935s1c1
Sequence:CCGGGCTCTCTATTCTTCAGAGAATCTCGAGATTCTCTGAAGAATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-2343s1c1
Sequence:CCGGCTGGCGTAACAAGAAGTCTAACTCGAGTTAGACTTCTTGTTACGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-919s1c1
Sequence:CCGGCCCTACTATGGTTACGTGTATCTCGAGATACACGTAACCATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-391s1c1
Sequence:CCGGCCCAGCACTAGAAGTGTCTTTCTCGAGAAAGACACTTCTAGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-2017s1c1
Sequence:CCGGCCAGTCAACGTGTTTGACATTCTCGAGAATGTCAAACACGTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130878
CDHR1 MISSION shRNA shRNA Plasmid DNA
cadherin-related family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130878.2-2935s1c1
Sequence:CCGGGCTCTCTATTCTTCAGAGAATCTCGAGATTCTCTGAAGAATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-2343s1c1
Sequence:CCGGCTGGCGTAACAAGAAGTCTAACTCGAGTTAGACTTCTTGTTACGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-919s1c1
Sequence:CCGGCCCTACTATGGTTACGTGTATCTCGAGATACACGTAACCATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-391s1c1
Sequence:CCGGCCCAGCACTAGAAGTGTCTTTCTCGAGAAAGACACTTCTAGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-2017s1c1
Sequence:CCGGCCAGTCAACGTGTTTGACATTCTCGAGAATGTCAAACACGTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130878
CDHR1 MISSION shRNA Lentiviral Transduction Particles
cadherin-related family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130878.2-2935s1c1
Sequence:CCGGGCTCTCTATTCTTCAGAGAATCTCGAGATTCTCTGAAGAATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-2343s1c1
Sequence:CCGGCTGGCGTAACAAGAAGTCTAACTCGAGTTAGACTTCTTGTTACGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-919s1c1
Sequence:CCGGCCCTACTATGGTTACGTGTATCTCGAGATACACGTAACCATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-391s1c1
Sequence:CCGGCCCAGCACTAGAAGTGTCTTTCTCGAGAAAGACACTTCTAGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130878.2-2017s1c1
Sequence:CCGGCCAGTCAACGTGTTTGACATTCTCGAGAATGTCAAACACGTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks