EMAIL THIS PAGE TO A FRIEND

CDHR2

cadherin-related family member 2

Synonyms: PCDH24 PCLKC
UniProtKB ID: Q9BYE9, A6NC80, Q9NXP8
Gene ID:
Human(54825) Summary: This gene is a member of the protocadherin family, which represents a subset of the larger cadherin superfamily. The members of the protocadherin family encode non-classical cadherins that function as calcium-dependent cell-cell adhesion molecules. This protocadherin represents a new candidate for tumor suppression. Alternatively spliced transcript variants that encode the same protein have been identified. [provided by RefSeq, Jan 2010]
Mouse(268663) cadherin-related family member 2
Rat(291002) cadherin-related family member 2
chicken(416223) cadherin-related family member 2
domestic cat(101081276) cadherin-related family member 2
Horse(100068810) cadherin-related family member 2
cow(511921) cadherin-related family member 2
dog(479280) cadherin-related family member 2
sheep(101118269) cadherin-related family member 2
Domestic Rabbit(100340222) cadherin-related family member 2
naked mole-rat(101709548) cadherin-related family member 2
domestic guinea pig(100724033) cadherin-related family member 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017675 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017675 Rosetta Predictions human pricing
XM_001070261 Rosetta Predictions rat pricing
XM_214434 Rosetta Predictions rat pricing
NM_001033364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064113 predicted 3307
2 SASI_Hs01_00064114 predicted 2936
3 SASI_Hs01_00064115 predicted 875
4 SASI_Hs01_00064117 predicted 2161
5 SASI_Hs01_00064118 predicted 2923
6 SASI_Hs01_00064119 predicted 2586
7 SASI_Hs02_00350409 predicted 1362
8 SASI_Hs01_00064120 predicted 683
9 SASI_Hs01_00064121 predicted 224
10 SASI_Hs01_00064122 predicted 224
11 SASI_Hs01_00064116 predicted 3609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331052 predicted 3520
2 SASI_Rn02_00331053 predicted 2354
3 SASI_Rn02_00331054 predicted 2336
4 SASI_Rn02_00331055 predicted 774
5 SASI_Rn02_00331056 predicted 2880
6 SASI_Rn02_00331057 predicted 211
7 SASI_Rn02_00331058 predicted 1833
8 SASI_Rn02_00331059 predicted 1910
9 SASI_Rn02_00331060 predicted 2337
10 SASI_Rn02_00331061 predicted 2805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375275 predicted 3262
2 SASI_Rn02_00375276 predicted 3297
3 SASI_Rn02_00375277 predicted 2089
4 SASI_Rn02_00375278 predicted 2084
5 SASI_Rn02_00375279 predicted 520
6 SASI_Rn02_00375280 predicted 2623
7 SASI_Rn02_00375281 predicted 1575
8 SASI_Rn02_00375282 predicted 1650
9 SASI_Rn02_00375283 predicted 2075
10 SASI_Rn02_00375284 predicted 2549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032124 predicted 3128
2 SASI_Mm01_00032125 predicted 405
3 SASI_Mm01_00032126 predicted 3147
4 SASI_Mm01_00032127 predicted 1120
5 SASI_Mm01_00032128 predicted 3688
6 SASI_Mm01_00032129 predicted 2797
7 SASI_Mm01_00032130 predicted 3050
8 SASI_Mm01_00032131 predicted 3319
9 SASI_Mm01_00032132 predicted 1764
10 SASI_Mm02_00288664 predicted 3026
11 SASI_Mm01_00032133 predicted 3310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033364
VALIDATED
CDHR2 MISSION shRNA Bacterial Glycerol Stock
cadherin-related family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-584s21c1
Sequence:CCGGGCCGGTTTGGTGCAATATTTCCTCGAGGAAATATTGCACCAAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-823s21c1
Sequence:CCGGAGACCTGGACCCTCGGTTTATCTCGAGATAAACCGAGGGTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-199s21c1
Sequence:CCGGGGTCAATATGACATTAGTAACCTCGAGGTTACTAATGTCATATTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-2748s21c1
Sequence:CCGGAGAGTGAGGCCATCGACTATGCTCGAGCATAGTCGATGGCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-3128s21c1
Sequence:CCGGACCAACCTAGATTCTACTATCCTCGAGGATAGTAGAATCTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033364
VALIDATED
CDHR2 MISSION shRNA shRNA Plasmid DNA
cadherin-related family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-584s21c1
Sequence:CCGGGCCGGTTTGGTGCAATATTTCCTCGAGGAAATATTGCACCAAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-823s21c1
Sequence:CCGGAGACCTGGACCCTCGGTTTATCTCGAGATAAACCGAGGGTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-199s21c1
Sequence:CCGGGGTCAATATGACATTAGTAACCTCGAGGTTACTAATGTCATATTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-2748s21c1
Sequence:CCGGAGAGTGAGGCCATCGACTATGCTCGAGCATAGTCGATGGCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-3128s21c1
Sequence:CCGGACCAACCTAGATTCTACTATCCTCGAGGATAGTAGAATCTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033364
VALIDATED
CDHR2 MISSION shRNA Lentiviral Transduction Particles
cadherin-related family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-584s21c1
Sequence:CCGGGCCGGTTTGGTGCAATATTTCCTCGAGGAAATATTGCACCAAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-823s21c1
Sequence:CCGGAGACCTGGACCCTCGGTTTATCTCGAGATAAACCGAGGGTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-199s21c1
Sequence:CCGGGGTCAATATGACATTAGTAACCTCGAGGTTACTAATGTCATATTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-2748s21c1
Sequence:CCGGAGAGTGAGGCCATCGACTATGCTCGAGCATAGTCGATGGCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033364.2-3128s21c1
Sequence:CCGGACCAACCTAGATTCTACTATCCTCGAGGATAGTAGAATCTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017675
CDHR2 MISSION shRNA Bacterial Glycerol Stock
cadherin-related family member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-1417s1c1
Sequence:CCGGCCATCCACCTTAGAGACATTACTCGAGTAATGTCTCTAAGGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-2540s1c1
Sequence:CCGGGCTGGAGATACAGCTTGTGAACTCGAGTTCACAAGCTGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-2402s1c1
Sequence:CCGGCGTGAATGTGAAAGACGTGAACTCGAGTTCACGTCTTTCACATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-3199s1c1
Sequence:CCGGGCGCCAACAGACAGGCGATTACTCGAGTAATCGCCTGTCTGTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-3641s1c1
Sequence:CCGGCCCAGGGACTAACATGTACAACTCGAGTTGTACATGTTAGTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017675
CDHR2 MISSION shRNA shRNA Plasmid DNA
cadherin-related family member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-1417s1c1
Sequence:CCGGCCATCCACCTTAGAGACATTACTCGAGTAATGTCTCTAAGGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-2540s1c1
Sequence:CCGGGCTGGAGATACAGCTTGTGAACTCGAGTTCACAAGCTGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-2402s1c1
Sequence:CCGGCGTGAATGTGAAAGACGTGAACTCGAGTTCACGTCTTTCACATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-3199s1c1
Sequence:CCGGGCGCCAACAGACAGGCGATTACTCGAGTAATCGCCTGTCTGTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-3641s1c1
Sequence:CCGGCCCAGGGACTAACATGTACAACTCGAGTTGTACATGTTAGTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017675
CDHR2 MISSION shRNA Lentiviral Transduction Particles
cadherin-related family member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-1417s1c1
Sequence:CCGGCCATCCACCTTAGAGACATTACTCGAGTAATGTCTCTAAGGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-2540s1c1
Sequence:CCGGGCTGGAGATACAGCTTGTGAACTCGAGTTCACAAGCTGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-2402s1c1
Sequence:CCGGCGTGAATGTGAAAGACGTGAACTCGAGTTCACGTCTTTCACATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-3199s1c1
Sequence:CCGGGCGCCAACAGACAGGCGATTACTCGAGTAATCGCCTGTCTGTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017675.2-3641s1c1
Sequence:CCGGCCCAGGGACTAACATGTACAACTCGAGTTGTACATGTTAGTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks